View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_156 (Length: 260)
Name: NF0856_high_156
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_high_156 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 30 - 260
Target Start/End: Original strand, 10106951 - 10107181
Alignment:
Q |
30 |
tatgtgactttatatagttgttgcaagagaagaggaaaattatataaaaccaatgtttttgtgattatttaattgttaatgggcaa-gttaggctgccct |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
10106951 |
tatgtgactttatatagttgttgcaagagaagaggaaaattatataaaaccaatgtttt-gtgattatttaattgttaatgggcaaagttaggctgccct |
10107049 |
T |
 |
Q |
129 |
aactttttgttttcgaggatttcaatgatatgcccattagcttatgtatgggagaggaaacaagtttggtggtcnnnnnnnnncattttagaaatgatat |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
T |
10107050 |
aactttttgttttcgaggatttcaatgatatgcccattagcttctgtatgggagaggagacaagtttggtggtctttttttttcattttagaaatgatat |
10107149 |
T |
 |
Q |
229 |
attgtaatatacttttaaataaactctcaaat |
260 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
10107150 |
attgtaatatacttttaaataaactctcaaat |
10107181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2890 times since January 2019
Visitors: 6167