View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_162 (Length: 254)
Name: NF0856_high_162
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_high_162 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 42450054 - 42449811
Alignment:
Q |
1 |
agtgtagattttggagacccatattgactaagaaacttcaatggacttcttgtgtcagaagccataaacccacgaagaaaaggtgcggactttgggcttt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42450054 |
agtgtagattttggagacccatattgactaagaaacttcaatggacttcttgtgtcagaagccataaacccacgaagaaaaggtgcggactttgggcttt |
42449955 |
T |
 |
Q |
101 |
tcttgggtaaatttgaaatgggtaccccttcttcaagaccctccatgagttcccaagcattgatgttgaagacagtttctgggtctttgtggggtggtga |
200 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42449954 |
tcttgggaaaatttgaaatgggtaccccttcttcaagaccctccatgagttcccaagcattgatgttgaagacagtttctgggtctttgtggggtggtga |
42449855 |
T |
 |
Q |
201 |
tgggtttgatttgggttctgtttttgactctgtttgtgtctctg |
244 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42449854 |
tgggtttgatttgggttctgtttttgactctgtttgtgtctctg |
42449811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1278 times since January 2019
Visitors: 6138