View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_164 (Length: 254)
Name: NF0856_high_164
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_high_164 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 27640638 - 27640772
Alignment:
| Q |
1 |
cttatggggtatactcagagtcggaggatgaaggaggcttttgagctttttgaagcgatgccggtgaagtggtttgttgcttgtaatgagatgatcttac |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27640638 |
cttatggggtatactcagagtgggaggatgaaggaggcttttgagctttttgaagcgatgccggtgaagtggattgttgcttgtaatgagatgatcttac |
27640737 |
T |
|
| Q |
101 |
agtttggacttgctggggagatgcatagagctagg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
27640738 |
agtttggacttgctggggagatgcatagagctagg |
27640772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3495 times since January 2019
Visitors: 6174