View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0856_high_165 (Length: 253)

Name: NF0856_high_165
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0856_high_165
NF0856_high_165
[»] chr5 (1 HSPs)
chr5 (30-253)||(14266606-14266830)
[»] chr8 (1 HSPs)
chr8 (39-118)||(29110653-29110732)


Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 30 - 253
Target Start/End: Original strand, 14266606 - 14266830
Alignment:
30 aagtaccttaccagatagaaaaggcatctactgagatttctgcattcttgagatatccagcaaacagaatcaatgccataaagtaccatgtttccaagct 129  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14266606 aagtaccttaccagatagagaaggcatctactgagatttctgcattcttgagatatccagcaaacagaatcaatgccataaagtaccatgtttccaagct 14266705  T
130 gcatgaaataaaatgtagaaatatttcttcgttttagcatcgaatacaac-gaatgtgttcatgaaattttagtggcaagaacttgactttataaacttt 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
14266706 gcatgaaataaaatgtagaaatatttcttcgttttagcatcgaatacaacggaatgtgttcatgaaattttagtggcaagaacttgactttataaacttt 14266805  T
229 aaaatagattgcaggagttattgac 253  Q
    |||||||||||||||||||||||||    
14266806 aaaatagattgcaggagttattgac 14266830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 39 - 118
Target Start/End: Original strand, 29110653 - 29110732
Alignment:
39 accagatagaaaaggcatctactgagatttctgcattcttgagatatccagcaaacagaatcaatgccataaagtaccat 118  Q
    |||| ||||| || ||||| ||||| | |||||||||||  |||||||||||||| || || ||||||||||| ||||||    
29110653 accatatagacaatgcatcaactgaaacttctgcattctccagatatccagcaaatagtattaatgccataaaataccat 29110732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2939 times since January 2019
Visitors: 6168