View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_169 (Length: 251)
Name: NF0856_high_169
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_high_169 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 2 - 188
Target Start/End: Original strand, 46588410 - 46588596
Alignment:
| Q |
2 |
caggagagaaattgagatgcctatcgaacaattaacattttcattactttaggcccaggctgaatcaggaaaagcttactatgccacatattagatacct |
101 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46588410 |
caggagagaaattgagatgcctattgaacaattaacattttcattactttaggcccaggctgaatcaggaaaagcttactatgccacatattagatacct |
46588509 |
T |
 |
| Q |
102 |
atcagctatcacatatgtgtgactatattcatgttctataaatggaaaatggtacattaaaaaggacagtaaactagtaagagggaa |
188 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46588510 |
atcagctatcacatatgtgtcactatattcatgttctataaatggaaaatgatacattaaaaaggacagtaaactcgtaagagggaa |
46588596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University