View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0856_high_17 (Length: 569)

Name: NF0856_high_17
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0856_high_17
NF0856_high_17
[»] chr5 (1 HSPs)
chr5 (30-169)||(41181235-41181374)


Alignment Details
Target: chr5 (Bit Score: 104; Significance: 1e-51; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 30 - 169
Target Start/End: Complemental strand, 41181374 - 41181235
Alignment:
30 acaacgatgctggcactaattgctatgatgttgaatattattatgatcaaggaggagatgttgggtattctcttcaatttggaggacctggtggttattg 129  Q
    |||||||||||||||||  |||||||| |||||||||||||  ||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||    
41181374 acaacgatgctggcactgtttgctatggtgttgaatattatggtgatcaaagtggaaatgttgggtattctcttcaatttggaggacctggtggttattg 41181275  T
130 tgagaattattaattttagtgaacttcatttgtttattac 169  Q
    |||||||||||||||||||||||| |||||||||||||||    
41181274 tgagaattattaattttagtgaacatcatttgtttattac 41181235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University