View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_184 (Length: 250)
Name: NF0856_high_184
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_high_184 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 134 - 221
Target Start/End: Complemental strand, 33659690 - 33659603
Alignment:
| Q |
134 |
ctgctttcaatattttgaacagaaaatagtttgatatattttggacacaagtgaaaacagtggtatttttgtaattaaaagtgaaaac |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33659690 |
ctgctttcaatattttgaacagaaaatagtttgatatattttggacacaagtgaaaacattggtatttttgtaattaaaagtgaaaac |
33659603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 33659824 - 33659769
Alignment:
| Q |
1 |
aaggatgctaggcactagtctgttggggggaagggaaaaggctaacgatctgtctg |
56 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33659824 |
aaggatgctaggcactagtctgttagggggaagggaaaaggctaacgatctgtctg |
33659769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University