View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_189 (Length: 244)
Name: NF0856_high_189
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_high_189 |
 | |
|
| [»] scaffold0133 (1 HSPs) |
| | |
|
| [»] scaffold0144 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0133 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: scaffold0133
Description:
Target: scaffold0133; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 26 - 171
Target Start/End: Original strand, 14695 - 14840
Alignment:
| Q |
26 |
attaaacaaggtttttaaactttaaaaatccctaggacttagtttgatggattcactaaggctagtaaatatctcttgtagtaaattggatcttcacctc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14695 |
attaaacaaggtttttaaactttaaaaatccctaggacttagtttgatggattcactaaggctagtaaatatctcttgtagtaaattggaccttcacctc |
14794 |
T |
|
| Q |
126 |
tttcttgtttccacgatattcatttatggcaaaatgtttaatcatt |
171 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||||||| ||||||| |
|
|
| T |
14795 |
tttcttgtttcaatgatattcacttatggcaaaatgttcaatcatt |
14840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 61; Significance: 3e-26; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 40 - 171
Target Start/End: Original strand, 16771681 - 16771831
Alignment:
| Q |
40 |
ttaaactttaaaaatccctaggacttagtttgatggattcactaaggctagtaaatatctctt-------------------gtagtaaattggatcttc |
120 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16771681 |
ttaaactttaaaaatccctagaacttggtttgatggattcactaaggctagtaaatatctcttgtaaaatttgtatgtcttggtagtaaattggatcttc |
16771780 |
T |
|
| Q |
121 |
acctctttcttgtttccacgatattcatttatggcaaaatgtttaatcatt |
171 |
Q |
| |
|
||||||||||| ||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
16771781 |
acctctttcttttttgaatgatattcatttatggcaaaatgttcaatcatt |
16771831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 40 - 98
Target Start/End: Original strand, 16733988 - 16734046
Alignment:
| Q |
40 |
ttaaactttaaaaatccctaggacttagtttgatggattcactaaggctagtaaatatc |
98 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16733988 |
ttaaactttaaaaatccctaggacttggtttgatggattcactaaggctagtaaatatc |
16734046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 170 - 234
Target Start/End: Original strand, 16734131 - 16734195
Alignment:
| Q |
170 |
ttattaagttattactcacatttccctattctttagtttagacaccagaacaggttcactctgtg |
234 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
16734131 |
ttattaggttattactcacatttccctattctttagttaagacaccagaacagaatcactctgtg |
16734195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 16771851 - 16771900
Alignment:
| Q |
178 |
ttattactcacatttccctattctttagtttagacaccagaacaggttcactctg |
232 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16771851 |
ttataactcacatttccctattcttta-----gacaccagaacaggttcactctg |
16771900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0144 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0144
Description:
Target: scaffold0144; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 118 - 171
Target Start/End: Original strand, 6341 - 6394
Alignment:
| Q |
118 |
ttcacctctttcttgtttccacgatattcatttatggcaaaatgtttaatcatt |
171 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| | |||||||||||||||| |
|
|
| T |
6341 |
ttcacctctttcttgtttgaatgatattcatttatagtaaaatgtttaatcatt |
6394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3333 times since January 2019
Visitors: 6172