View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_212 (Length: 223)
Name: NF0856_high_212
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_high_212 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 19 - 154
Target Start/End: Original strand, 14420249 - 14420384
Alignment:
| Q |
19 |
caaatatgatccaaaaactgtctctaaaagatcatttggcaatagaactatttccttaaggaatcatgagtttcataaagaatatatggaaggtaactta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14420249 |
caaatatgatccaaaaactgtctctaaaagatcatttggcaatagaactatttccttaaggaatcatgagtttcataaagaatatatggaaggtaactta |
14420348 |
T |
|
| Q |
119 |
tatagaaatttatggtctgtttggtttaagaaaatg |
154 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14420349 |
tatagaaatttaaggtctgtttggtttaagaaaatg |
14420384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3923 times since January 2019
Visitors: 6176