View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_231 (Length: 208)
Name: NF0856_high_231
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_high_231 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 32 - 180
Target Start/End: Complemental strand, 32750284 - 32750136
Alignment:
| Q |
32 |
tttggaattaagacactagaaggcaaatgatttatgagataagatgcagctaaaactgccttcctaagctttttcgagaaccttattttggaataatata |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32750284 |
tttggaattaagacactagaaggcaaatgatttatgagataagatgcagctaaaactgccttcctaagctttttcgagaaccttattttgaaataatata |
32750185 |
T |
|
| Q |
132 |
gtttgagtttgatcaaacaagtgctaatgttttctcttagcaacctcat |
180 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
32750184 |
gtttgagtttgatcaaacaagtgcccattttttctcttagcaacctcat |
32750136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 176
Target Start/End: Complemental strand, 50058921 - 50058786
Alignment:
| Q |
43 |
gacactagaaggcaaatgatttatgagataagatgcagctaaaactgccttcct--aagctttttcgagaaccttattttggaataatatagtttgagtt |
140 |
Q |
| |
|
|||||||||||| ||| | |||||||| |||||||| | ||||||||||| || || ||| | ||||||||||||||||||| |||| | ||||| |
|
|
| T |
50058921 |
gacactagaaggtaaacggtttatgaggtaagatgctgttaaaactgcctccccccaaaatttcttaggaaccttattttggaataacatagctcgagtt |
50058822 |
T |
|
| Q |
141 |
tgatcaaacaagtgctaatgttttctcttagcaacc |
176 |
Q |
| |
|
||||| ||||| ||| || |||||||| ||||||| |
|
|
| T |
50058821 |
tgatctaacaaatgcccattttttctctcagcaacc |
50058786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 28094515 - 28094564
Alignment:
| Q |
43 |
gacactagaaggcaaatgatttatgagataagatgcagctaaaactgcct |
92 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| |||||| |||| |
|
|
| T |
28094515 |
gacactagaaggtaaacgatttatgagataagatgcaattaaaaccgcct |
28094564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 43 - 86
Target Start/End: Complemental strand, 31972658 - 31972615
Alignment:
| Q |
43 |
gacactagaaggcaaatgatttatgagataagatgcagctaaaa |
86 |
Q |
| |
|
|||| ||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
31972658 |
gacattagaaggtaaacgatttatgagataagatgcagctaaaa |
31972615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 29442362 - 29442408
Alignment:
| Q |
41 |
aagacactagaaggcaaatgatttatgagataagatgcagctaaaac |
87 |
Q |
| |
|
|||||| ||||||| ||| ||||||||||||||||||||| |||||| |
|
|
| T |
29442362 |
aagacaatagaaggtaaacgatttatgagataagatgcagttaaaac |
29442408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2076 times since January 2019
Visitors: 6156