View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0856_high_232 (Length: 208)

Name: NF0856_high_232
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0856_high_232
NF0856_high_232
[»] chr4 (1 HSPs)
chr4 (1-133)||(4142302-4142434)


Alignment Details
Target: chr4 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 4142434 - 4142302
Alignment:
1 cgttattaccatacaaaataacacagtttatagaatagggttttgtcttcagctctgaacccacccacctacggcggaacttatctctgaggagtgaaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4142434 cgttattaccatacaaaataacacagtttatagaatagggttttgtcttcagctctgaacccacccacctacggcggaacttatctctgaggagtgaaga 4142335  T
101 gcagattctgcagaagacttcaacatggttcgt 133  Q
    |||||||||||||||||||||||||||||||||    
4142334 gcagattctgcagaagacttcaacatggttcgt 4142302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2308 times since January 2019
Visitors: 6161