View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_236 (Length: 204)
Name: NF0856_high_236
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_high_236 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 15 - 171
Target Start/End: Original strand, 32750128 - 32750284
Alignment:
Q |
15 |
ccaacaaaatgaggttgctaagagaaaacattagcacttgtttgatcaaactcaaactatattattccaaaataaggttctcgaaaaagcttaggaaggc |
114 |
Q |
|
|
|||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
32750128 |
ccaacaaaatgaggttgctaagagaaaaaatgggcacttgtttgatcaaactcaaactatattatttcaaaataaggttctcgaaaaagcttaggaaggc |
32750227 |
T |
 |
Q |
115 |
agttttagctgcatcttatctcataaatcatttgccttctagtgtcttaattccaaa |
171 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32750228 |
agttttagctgcatcttatctcataaatcatttgccttctagtgtcttaattccaaa |
32750284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 160
Target Start/End: Original strand, 50058774 - 50058921
Alignment:
Q |
15 |
ccaacaaaatgaggttgctaagagaaaacattagcacttgtttgatcaaactcaaactatattattccaaaataaggttctcgaaaaagctt--aggaag |
112 |
Q |
|
|
||||||||||| ||||||| |||||||| || ||| ||||| |||||||||| | |||| ||||||||||||||||||| | ||| || || || |
|
|
T |
50058774 |
ccaacaaaatggggttgctgagagaaaaaatgggcatttgttagatcaaactcgagctatgttattccaaaataaggttcctaagaaattttggggggag |
50058873 |
T |
 |
Q |
113 |
gcagttttagctgcatcttatctcataaatcatttgccttctagtgtc |
160 |
Q |
|
|
||||||||| | |||||||| |||||||| | ||| |||||||||||| |
|
|
T |
50058874 |
gcagttttaacagcatcttacctcataaaccgtttaccttctagtgtc |
50058921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 28094660 - 28094515
Alignment:
Q |
17 |
aacaaaatgaggttgctaagagaaaacattagcacttgtttgatcaaactcaaactatattattccaaaataaggttctcgaaaaagctt--aggaaggc |
114 |
Q |
|
|
||||||||| ||||||| |||||||| || || ||||| |||||||||||| |||| ||||| ||||||||||||| | | | || || |||| |
|
|
T |
28094660 |
aacaaaatggggttgctgagagaaaaaatggccatttgttagatcaaactcaagctatgttatttcaaaataaggttcctaagagattttggggggaggc |
28094561 |
T |
 |
Q |
115 |
agttttagctgcatcttatctcataaatcatttgccttctagtgtc |
160 |
Q |
|
|
|||||| |||||||||||||||||||| ||| |||||||||||| |
|
|
T |
28094560 |
ggttttaattgcatcttatctcataaatcgtttaccttctagtgtc |
28094515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 117 - 160
Target Start/End: Original strand, 31972615 - 31972658
Alignment:
Q |
117 |
ttttagctgcatcttatctcataaatcatttgccttctagtgtc |
160 |
Q |
|
|
||||||||||||||||||||||||||| ||| ||||||| |||| |
|
|
T |
31972615 |
ttttagctgcatcttatctcataaatcgtttaccttctaatgtc |
31972658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 162
Target Start/End: Complemental strand, 29442408 - 29442362
Alignment:
Q |
116 |
gttttagctgcatcttatctcataaatcatttgccttctagtgtctt |
162 |
Q |
|
|
|||||| ||||||||||||||||||||| ||| ||||||| |||||| |
|
|
T |
29442408 |
gttttaactgcatcttatctcataaatcgtttaccttctattgtctt |
29442362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2730 times since January 2019
Visitors: 6167