View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_47 (Length: 440)
Name: NF0856_high_47
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_high_47 |
 |  |
|
| [»] scaffold0432 (1 HSPs) |
 |  |  |
|
| [»] scaffold0402 (1 HSPs) |
 |  |  |
|
| [»] scaffold0287 (1 HSPs) |
 |  |  |
|
| [»] scaffold0778 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0595 (1 HSPs) |
 |  |  |
|
| [»] scaffold0061 (1 HSPs) |
 |  |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
| [»] scaffold0457 (1 HSPs) |
 |  |  |
|
| [»] scaffold0515 (1 HSPs) |
 |  |  |
|
| [»] scaffold0306 (1 HSPs) |
 |  |  |
|
| [»] scaffold0122 (2 HSPs) |
 |  |  |
|
| [»] scaffold0163 (2 HSPs) |
 |  |  |
|
| [»] scaffold0882 (1 HSPs) |
 |  |  |
|
| [»] scaffold0244 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0242 (2 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0548 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold1348 (1 HSPs) |
 |  |  |
|
| [»] scaffold0633 (1 HSPs) |
 |  |  |
|
| [»] scaffold0098 (1 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0364 (1 HSPs) |
 |  |  |
|
| [»] scaffold0067 (1 HSPs) |
 |  |  |
|
| [»] scaffold0795 (1 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 274; Significance: 1e-153; HSPs: 143)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 29 - 306
Target Start/End: Original strand, 43347920 - 43348197
Alignment:
| Q |
29 |
caaagattacaaaagattcaacggacacatccctcatgaatgcttcaaaacacaattctaatcctaaattctagttctaattctaatctaagcatttgcc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43347920 |
caaagattacaaaagattcaacggacacatccctcatgaatgcttcaaaacacaattctaatcctaaattctagttctaattctaatctaagcatttgcc |
43348019 |
T |
 |
| Q |
129 |
ataaatagccatttctttgcaatttgtcacagtcttggtgatttactgatttcattcttgtattgaattgaatcaaattactattatcttataataaatg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43348020 |
ataaatagccatttctttgcaatttgtcacagtcttggtgatttactgatttcattcttgtattgaattgaatcaaattactattatcttataataaatg |
43348119 |
T |
 |
| Q |
229 |
aaatgataataaatttccatgaacacgatgctaattgtacacttctatcatattactcaactaaatactcattcacat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43348120 |
aaatgataataaatttccatgaacacgatgctagttgtacacttctatcatattactcaactaaatactcattcacat |
43348197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 2733615 - 2733691
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2733615 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
2733691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 305 - 385
Target Start/End: Original strand, 3054021 - 3054101
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggtgcc |
385 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
3054021 |
atatccagaagttctagctcaactggcaaaatgccgaaattgttaggccggatgccatgactgggttcgaaacccggtgcc |
3054101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 14188087 - 14188165
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14188087 |
atatccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgacctgggttcgaaccccggt |
14188165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 25250783 - 25250860
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25250783 |
tatccagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccccggt |
25250860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 36586480 - 36586557
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
36586480 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggt |
36586557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 37295128 - 37295201
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37295128 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
37295201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 4430864 - 4430788
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
4430864 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
4430788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 6317299 - 6317375
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
6317299 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
6317375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 19649627 - 19649551
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19649627 |
atccagaagtcatagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
19649551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 27928157 - 27928233
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
27928157 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttagaccggatgccatgaccggggttcgaaccccggt |
27928233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 34711684 - 34711608
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
34711684 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggt |
34711608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 25199043 - 25199121
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
25199043 |
atatccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgctatgaccgggtttcgaaccccggt |
25199121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 38070612 - 38070534
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
38070612 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgacatgaccgggattcgaaccacggt |
38070534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 4977164 - 4977087
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
4977164 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggaccccatgaccggggttcgaaccccggt |
4977087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 310 - 378
Target Start/End: Original strand, 26690696 - 26690765
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26690696 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
26690765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 38953610 - 38953533
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
38953610 |
tatccagaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
38953533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 11100417 - 11100341
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
11100417 |
atccagaagtcctagctcaactggaaaaatgccgaaattgttaggccggatgccatgatcggagttcgaaccccggt |
11100341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 24654973 - 24655049
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24654973 |
atccagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgactggggttcgaaccccggt |
24655049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 310 - 385
Target Start/End: Original strand, 25213631 - 25213707
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggtgcc |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||| |
|
|
| T |
25213631 |
cagaagtcctagctcaactggcaaaatgccgaaattgttagaccggatgccatgatcggggttcgaaccccggtgcc |
25213707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 26737970 - 26738046
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
26737970 |
atccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
26738046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 43820867 - 43820943
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
43820867 |
atccagaagtcctaactcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt |
43820943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 44814866 - 44814938
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
44814866 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
44814938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 312 - 382
Target Start/End: Original strand, 9569728 - 9569799
Alignment:
| Q |
312 |
gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9569728 |
gaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
9569799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 309 - 382
Target Start/End: Complemental strand, 6845110 - 6845036
Alignment:
| Q |
309 |
ccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
6845110 |
ccagaagtcctagctcaattggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggt |
6845036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 7772181 - 7772103
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
7772181 |
atatccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggt |
7772103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 311 - 380
Target Start/End: Original strand, 10096615 - 10096685
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10096615 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccg |
10096685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 2442760 - 2442837
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
2442760 |
tatccataagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccgggattcaaaccccggt |
2442837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 25063338 - 25063415
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25063338 |
atccagaagtcctagttcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
25063415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 25893853 - 25893926
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
25893853 |
cagaagtcctagctcaactggcaaaatgctgaaattgttaggccggatgccatgatcggggttcgaaccccggt |
25893926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 31639232 - 31639155
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
31639232 |
tatccagaagtcctaactcaactagcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaactccggt |
31639155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 33067518 - 33067441
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||| |
|
|
| T |
33067518 |
tatccggaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaactccggt |
33067441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 37708577 - 37708500
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||||| |
|
|
| T |
37708577 |
tatccataagtcctagctcaactggcaaaatgccgaaattgttaggacggatgctatgaccggggttcgaaccccggt |
37708500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 4312132 - 4312208
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
4312132 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgactggggttcgaactccggt |
4312208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 17649970 - 17649895
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
17649970 |
atccagaaatcctagctcaactggcaaaataccgaaattgttaagccggatgtcatgatcgggttcgaaccccggt |
17649895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 37817374 - 37817449
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
37817374 |
tatccataagtcctagctcaactggcaaaatgacgaaattgttaggtcggatgccatgaccggggttcgaaccccg |
37817449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 8569943 - 8570020
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
8569943 |
tatccagaagtcctagctcaactggcaaaagaccgaaattgttaggccggatgcaatgactggggttcgaaccccggt |
8570020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 9998773 - 9998696
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
9998773 |
tatctagaagtcctagttcaactggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccccggt |
9998696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 23681012 - 23681085
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23681012 |
cagaagtcctaactcaactggcaaaatgccaaaattattaggccggatgccatgaccggggttcgaaccccggt |
23681085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 24242715 - 24242638
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24242715 |
atccagaagtcctaactcaaccggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
24242638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 307 - 379
Target Start/End: Complemental strand, 35421747 - 35421674
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
35421747 |
atccagaagtcctagttcaactggcaaaatgtcgaaattgttaggccgaatgccatgaccggggttcgaacccc |
35421674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 40744371 - 40744299
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
40744371 |
atccagaagtcctagctcaactggcaaaatgtcaaaattgttaggccagatgccatgaccggagttcgaaccc |
40744299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 41562441 - 41562517
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||| |||| | |||||||||||||||| |
|
|
| T |
41562441 |
atccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggt |
41562517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 308 - 382
Target Start/End: Original strand, 403666 - 403741
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
403666 |
tccacaagtcctagctcaactgataaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggt |
403741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 306 - 369
Target Start/End: Complemental strand, 34143484 - 34143421
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||| ||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34143484 |
tatccagaagtcctaactcaattagcaaaatgccgaaattgttaggccggatgccatgaccggg |
34143421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 369
Target Start/End: Complemental strand, 34540190 - 34540131
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34540190 |
cagaagtcctagttcaactggcaaaatgccgaaattgttaggccggatgccatgatcggg |
34540131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 35810235 - 35810298
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35810235 |
tatccacaagttatagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
35810298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 376
Target Start/End: Complemental strand, 8547259 - 8547189
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaac |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||| |||||||| |
|
|
| T |
8547259 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcataaccggagttcgaac |
8547189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 306 - 379
Target Start/End: Complemental strand, 20990543 - 20990469
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||| |||||| ||||||| ||||||||||||| |
|
|
| T |
20990543 |
tatccagaagttctagctcaactggcaaaatgccgacattgttaggtcggatgtcatgaccagggttcgaacccc |
20990469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 34744397 - 34744319
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||| || |||||||||| |||| |
|
|
| T |
34744397 |
atatccagaagtcatagctcaactggcaaaatgccgatattgttagggcggatgccatgatcgtggttcgaacctcggt |
34744319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 44604944 - 44604874
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
44604944 |
aagtcctagctcaattggcaaaatgccgaaattgttaggtcggatgccatgatcggggttcgaaccccggt |
44604874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 14243701 - 14243774
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| | ||| |||||||| ||||||||||||||| |
|
|
| T |
14243701 |
cagaagtcctagctcaactggtaaaatgccgaaattgttaggctgaatgtcatgaccgaggttcgaaccccggt |
14243774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 26226841 - 26226765
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||| |||||| |||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26226841 |
tatccagaagtccaagctcagctgg-aaaatgctgaaattgttaggccggatgccatgaccgaggttcgaaccccggt |
26226765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 5704757 - 5704681
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||||||| ||||||| ||||||||||||||| |||||||||||| ||||| |||||||||| |
|
|
| T |
5704757 |
atccacaagtcctagctcaactgacaaaatgtcgaaattgttaggccagatgccatgaccggggtttgaaccccggt |
5704681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 5895924 - 5895848
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||| |||| |||| | |||||||||||||||| |
|
|
| T |
5895924 |
atccataagtcctagctcaactggcaaaatgtcgaaattgttaggccgaatgctatgatcggggttcgaaccccggt |
5895848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 10617788 - 10617860
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
10617788 |
agaagtcctagctcaactgacaaaatgccgacattgttaggccggatgtcatgactggggttcgaaccccggt |
10617860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 16395372 - 16395448
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||| |||||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
16395372 |
atccagaagtcctaactcaactggtaaaatgctgaaattgttaggccggatactatgaccggggttcgaaccccggt |
16395448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 306 - 369
Target Start/End: Complemental strand, 4694817 - 4694754
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
4694817 |
tatccataagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgtcatgaccggg |
4694754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 369
Target Start/End: Original strand, 26675559 - 26675618
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26675559 |
cagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatatcatgaccggg |
26675618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 313 - 379
Target Start/End: Complemental strand, 32922997 - 32922930
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
32922997 |
aagtcctaactcaattggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaacccc |
32922930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 365
Target Start/End: Complemental strand, 39667021 - 39666966
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39667021 |
cagaagtcctaactcaactgacaaaatgccgaaattgttaggccggatgccatgac |
39666966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 18040133 - 18040211
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||| || | ||||||||||||| |
|
|
| T |
18040133 |
atatccagaagtcctagctcaactgataaaatgctgaaattgttaggccggatgtcatgacccagattcgaaccccggt |
18040211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 306 - 368
Target Start/End: Original strand, 20150219 - 20150281
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg |
368 |
Q |
| |
|
||||||||| |||||||||||||||||||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
20150219 |
tatccagaattcctagctcaactggcaaaatgtcaaaattgttaggccggatgtcatgaccgg |
20150281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 16501651 - 16501724
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| ||| || |||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
16501651 |
agaagtcctagctcaactggcaaaaatgctgatattgttaggctggatgccatgaccggggttcgaaccccggt |
16501724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 27545046 - 27544969
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||| |||||| ||| || |||||||||||||||| |
|
|
| T |
27545046 |
tatccagaagttctagctcaactggcaaaatgtcgaaattgttaggtcggatgttatgtccggggttcgaaccccggt |
27544969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 27849872 - 27849796
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| |||||||| ||||| ||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
27849872 |
atccagaagtcctaactcaactgacaaaaatgccgaaattgttaggccggatg-catgaccggggttcgaaccccggt |
27849796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 308 - 369
Target Start/End: Complemental strand, 41746776 - 41746715
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
41746776 |
tccagaagtcctagctcaactgacaaaatgccaaaattattaggccggatgccatgatcggg |
41746715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 306 - 377
Target Start/End: Original strand, 15129635 - 15129707
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaacc |
377 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||| | |||||||||| || |||||||||| |
|
|
| T |
15129635 |
tatccagaagtcctagctcaaccggcaaaatgccaaaattgttaggtctgatgccatgatcgaggttcgaacc |
15129707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 21530779 - 21530855
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
||||||| || ||||||||||| ||||||| |||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
21530779 |
atccagatgttctagctcaactagcaaaataccgaaattgttaggtcggatgccatgaccgaggttcgaatcccggt |
21530855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 35222272 - 35222348
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
||||| || ||||||||||||||| |||||| ||||||||||||| ||||| ||||||||| ||||||||||||||| |
|
|
| T |
35222272 |
atccacaaatcctagctcaactggtaaaatgtcgaaattgttaggtcggataccatgaccgaggttcgaaccccggt |
35222348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 313 - 379
Target Start/End: Complemental strand, 5700771 - 5700705
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
5700771 |
aagtcctaactcaactggcaaa-tgccgaaattgttaggccggatgctatgaccggggttcgaacccc |
5700705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 6436707 - 6436758
Alignment:
| Q |
332 |
aaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6436707 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
6436758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 2589285 - 2589363
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||||| || || |||||||||||| |||||||| |||||||||||| | |||||||||||||| |||||||||||||| |
|
|
| T |
2589285 |
atatccggatgttctagctcaactgacaaaatgctgaaattgttaggtcagatgccatgaccggagttcgaaccccggt |
2589363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 13634845 - 13634907
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| | |||| ||||| |||| |
|
|
| T |
13634845 |
atccagaagtcttagctcaactggcaaaatgccgaaattgttaggtcagatgtcatgatcggg |
13634907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 13735258 - 13735320
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| | |||| ||||| |||| |
|
|
| T |
13735258 |
atccagaagtcttagctcaactggcaaaatgccgaaattgttaggtcagatgtcatgatcggg |
13735320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 20662521 - 20662583
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||| |||||| | ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20662521 |
atccagaagtcctacctcaaccgctaaaatgctgaaattgttaggccggatgccatgaccggg |
20662583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 319 - 380
Target Start/End: Complemental strand, 36372140 - 36372078
Alignment:
| Q |
319 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
36372140 |
tagctcaactggcaaaatgccgaaattgttaggccggatatcatgactggggttcgaaccccg |
36372078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 319 - 380
Target Start/End: Original strand, 40999764 - 40999826
Alignment:
| Q |
319 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccg |
380 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40999764 |
tagctcaactgataaaatgtcgaaattgttaggccggatgccatgaccgggattcgaaccccg |
40999826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 2527200 - 2527277
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| |||||||||||||||||| || ||||||||| |||||||||||| || ||||||||| |||||| |
|
|
| T |
2527200 |
tatccagaagtcttagctcaactggcaaaatcccaaaattgttaagccggatgccataactggggttcgaatcccggt |
2527277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 24242028 - 24241951
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| |||||||||||| ||||||||||| ||| |||||||| ||||| |
|
|
| T |
24242028 |
tatccagaagtcatagctcaactggtaaaatgcagaaattgttaggttggatgccatgatcggagttcgaactccggt |
24241951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 382 - 423
Target Start/End: Complemental strand, 32526623 - 32526582
Alignment:
| Q |
382 |
tgccatctccttggatttcaattgcagcaaaccttgatgatg |
423 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32526623 |
tgccatctccttggatttcaattgcagcaaaccttgatgatg |
32526582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 40344488 - 40344560
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatg-accgggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||| |||||||| |||| || |||||||||||| |
|
|
| T |
40344488 |
tatccagaagtcctagttcaactgtcaaaatgccgaaattgtta-gccggatgtcatgaacggggttcgaaccc |
40344560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 29158797 - 29158873
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||| ||||| |||||||| |||| | |||||||||||||||||||| |||||| | |||||||||||||||| |
|
|
| T |
29158797 |
atccagaaatcctaactcaactgacaaagtaccgaaattgttaggccggataccatgatcggggttcgaaccccggt |
29158873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 313 - 380
Target Start/End: Original strand, 37953788 - 37953856
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||| |||| | ||||||||||||| |
|
|
| T |
37953788 |
aagtcctagctcaactggaaaaatgtcgaaattgttaggccggatgctatgattgtggttcgaaccccg |
37953856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 38017303 - 38017227
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||| |||||||||||| |||||||||||||| ||| |||||||| |||||| |||||||||||||||| |
|
|
| T |
38017303 |
atccaaaagtcatagctcaactggaaaaatgccgaaattattaagccggatgtcatgacgggggttcgaaccccggt |
38017227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 306 - 369
Target Start/End: Complemental strand, 2508264 - 2508201
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||| ||||||||||| |||||| |||||||||| |
|
|
| T |
2508264 |
tatccagaagtcctaactcaactaacaaaatgccaaaattgttaggacggatgtcatgaccggg |
2508201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 11564996 - 11565075
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
||||| |||| ||||| |||||||||||||| ||| |||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
11564996 |
atatctagaaatcctaactcaactggcaaaaatgctgaaattgttaggccggatgctatgaccggagttcgaactccggt |
11565075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 314 - 369
Target Start/End: Complemental strand, 34642559 - 34642504
Alignment:
| Q |
314 |
agtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
34642559 |
agtcctacctgaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggg |
34642504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 321 - 382
Target Start/End: Complemental strand, 8525316 - 8525254
Alignment:
| Q |
321 |
gctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||| ||||||||||| |||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
8525316 |
gctcaactgacaaaatgccgacattgttagaccggatgccatgactggggttcgaaccccggt |
8525254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 38216884 - 38216822
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||| ||| ||||||| |||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
38216884 |
atccagaagtcttagttcaactgaaaaaatgccgaaattgttaggccagatgtcatgaccggg |
38216822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 311 - 380
Target Start/End: Original strand, 41278604 - 41278674
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
||||||| |||||||||||||||||| || |||||||||||| |||||| ||||| || |||||||||||| |
|
|
| T |
41278604 |
agaagtcttagctcaactggcaaaataccaaaattgttaggctggatgctatgactggagttcgaaccccg |
41278674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 360
Target Start/End: Complemental strand, 11265185 - 11265132
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgcc |
360 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
11265185 |
atccagaagtcctagttcaactgacaaaatgtcaaaattgttaggccggatgcc |
11265132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 379
Target Start/End: Complemental strand, 12702423 - 12702354
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaacccc |
379 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||| ||| |||| | |||||||||||| |
|
|
| T |
12702423 |
agaagtcctagctcaactggttaaataccgaaattgttaggccggacgccttgacggaggttcgaacccc |
12702354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 364
Target Start/End: Original strand, 22762003 - 22762060
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||||||||| |||| ||||||| ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
22762003 |
atccagaagttctagttcaactgacaaaatgccgaaattgttaggtcggatgtcatga |
22762060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 330 - 382
Target Start/End: Complemental strand, 27817555 - 27817502
Alignment:
| Q |
330 |
gcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||| |||||||||||||||| |
|
|
| T |
27817555 |
gcaaaatgccgaaattgttagaccggatgtcatgaccggggttcgaaccccggt |
27817502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 364
Target Start/End: Original strand, 42650167 - 42650224
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
||||| |||||||| |||||| || |||||||||||||||||||| |||||||||||| |
|
|
| T |
42650167 |
atccacaagtcctaactcaaccggtaaaatgccgaaattgttaggtcggatgccatga |
42650224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 313 - 380
Target Start/End: Complemental strand, 5682346 - 5682278
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
||||||| |||||||| |||||||| ||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
5682346 |
aagtcctcgctcaactagcaaaatgttgaaattgttaggccggatgttatgaccggagttcgaaccccg |
5682278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 6602642 - 6602575
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
6602642 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
6602575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 6678095 - 6678028
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
6678095 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
6678028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 313 - 349
Target Start/End: Complemental strand, 7432618 - 7432582
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgtta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7432618 |
aagtcctagctcaactggcaaaatgccgaaattgtta |
7432582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 10286594 - 10286518
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||| ||| || || ||| ||| ||||||||||||| |
|
|
| T |
10286594 |
atccagaagtcctagctcaactggcaaaatgtcaaaattgttagaccgaataccgtgattgggattcgaaccccggt |
10286518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 11098203 - 11098127
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| |||||||| |||||| ||||||||||||| || ||| |||||| |||||||||||||||| |
|
|
| T |
11098203 |
atccagaagtcctaactcaactgacaaaatatcgaaattgttaggtcgaatgtcatgactggggttcgaaccccggt |
11098127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 310 - 369
Target Start/End: Original strand, 16816827 - 16816887
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||| |||||||||||||||||||| || |||||||||||||||| ||||||| |||||| |
|
|
| T |
16816827 |
cagaactcctagctcaactggcaaaaatgtcgaaattgttaggccgaatgccataaccggg |
16816887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 20993536 - 20993612
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||||| | |||||| ||||||||||||||||||||| |||| | |||||||||||||||| |
|
|
| T |
20993536 |
atccataagtcctagctcaatcgataaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggt |
20993612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 306 - 350
Target Start/End: Original strand, 23554868 - 23554912
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttag |
350 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23554868 |
tatccagaaatcctagctcaactggtaaaatgccgaaattgttag |
23554912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 310 - 358
Target Start/End: Original strand, 41897826 - 41897874
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg |
358 |
Q |
| |
|
||||||||||| |||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
41897826 |
cagaagtcctaactcaactgacaaaataccgaaattgttaggccggatg |
41897874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 313 - 379
Target Start/End: Original strand, 10006151 - 10006218
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
||||| ||||||||||||||||||| | |||||||||| ||||||| ||||| | ||||||||||||| |
|
|
| T |
10006151 |
aagtcttagctcaactggcaaaatgtcaaaattgttagaccggatgtcatgatcggggttcgaacccc |
10006218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 305 - 378
Target Start/End: Complemental strand, 29845216 - 29845142
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||| ||||||||||||| |||||||||||| | |||||||||||| |
|
|
| T |
29845216 |
atatccagaagtcctagttcaactggcaaaaatatcgaaattgttagg-cggatgccatgatcggggttcgaaccc |
29845142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 31941164 - 31941089
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
||||||||||| ||| |||| |||||||| ||||||||||||||||| ||||| ||||| | |||||||||||||| |
|
|
| T |
31941164 |
atccagaagtcttagttcaattggcaaaaatgccgaaattgttaggctggatgtcatgatcggggttcgaaccccg |
31941089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 45406321 - 45406384
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||| |||||||||||||| | ||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
45406321 |
tatccaaaagtcctagctcaatcgataaaatgccgaaattgttaggccggatgtcatgatcggg |
45406384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 1766713 - 1766783
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| || ||||||| |||||||||||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
1766713 |
aagtcctagctcaattgtcaaaatgttgaaattgttaggtcggatgctgtgaccgaggttcgaaccccggt |
1766783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 3728455 - 3728381
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
|||||||||||| |||||||||| |||||| ||||||||||||| |||||| ||||| |||||||||||||| |
|
|
| T |
3728455 |
atccagaagtcccagctcaactgacaaaatatcgaaattgttaggtcggatgtcatgattggggttcgaaccccg |
3728381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 306 - 348
Target Start/End: Complemental strand, 23872841 - 23872799
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgtt |
348 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
23872841 |
tatccagaagtcctaactcaactggcaaaatgccaaaattgtt |
23872799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 310 - 364
Target Start/End: Original strand, 29513878 - 29513931
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||| |||| |||||| |
|
|
| T |
29513878 |
cagaagtcctagctcaactgacaaa-tgccgaaattgttaggctggataccatga |
29513931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 310 - 378
Target Start/End: Original strand, 30089960 - 30090030
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
|||||||| |||||||||| |||||| ||||||||||||||| ||| ||||||||| | |||||||||||| |
|
|
| T |
30089960 |
cagaagtcatagctcaacttgcaaaaatgccgaaattgttagcccgaatgccatgatcggggttcgaaccc |
30090030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 31261078 - 31261008
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||| | || |||||||||| ||||||||||||| |||| ||||||| | |||||||||||||||| |
|
|
| T |
31261078 |
aagtcctagattaattggcaaaatgtcgaaattgttaggtcggacgccatgatcggggttcgaaccccggt |
31261008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 307 - 365
Target Start/End: Original strand, 39333944 - 39334002
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
39333944 |
atccacaagtcctagcttaactggcaaaatgctaaacttgttaggccggatgtcatgac |
39334002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 338 - 382
Target Start/End: Complemental strand, 40772663 - 40772618
Alignment:
| Q |
338 |
ccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
40772663 |
ccgaaattgttaggccggatgccatgatcggggttcgaaccccggt |
40772618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 42922541 - 42922614
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||| | |||||| | ||| | |||||||||||||||| |
|
|
| T |
42922541 |
cagaagtcttagctcaactggcaaaatgtcgaaattgtttgatcggatgtcgtgatcggggttcgaaccccggt |
42922614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 313 - 381
Target Start/End: Original strand, 43129101 - 43129170
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccgg |
381 |
Q |
| |
|
|||||||| |||||| | ||||| |||||||||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
43129101 |
aagtcctatctcaaccgaaaaaataccgaaattgttaggtcggatgccatgatcgggattcgaaccccgg |
43129170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 356
Target Start/End: Original strand, 1522697 - 1522741
Alignment:
| Q |
313 |
aagtcctagctcaactggc-aaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
1522697 |
aagtcctagctcaactggcaaaaataccgaaattgttaggccgga |
1522741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 316 - 382
Target Start/End: Complemental strand, 3673964 - 3673896
Alignment:
| Q |
316 |
tcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| | |||||||||||| |||||||||| |||| |
|
|
| T |
3673964 |
tcctagctcaactggcaaaaatgtcgaaattgttaggtcatatgccatgaccgtggttcgaaccgcggt |
3673896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 12534842 - 12534775
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | | ||| |||||||||||||| |
|
|
| T |
12534842 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcgtgatccgggttcgaaccc |
12534775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 306 - 385
Target Start/End: Complemental strand, 36482186 - 36482106
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggtgcc |
385 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||| |||||||||||||||| |||| |||| | |||||||||| ||| |||| |
|
|
| T |
36482186 |
tatccagaagtcttagcttaactgataaaatgtcgaaattgttaggccgaatgctatgatcggggttcgaactccgatgcc |
36482106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 42192763 - 42192696
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| ||| |||||||||| |
|
|
| T |
42192763 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgagttcgaaccc |
42192696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 382
Target Start/End: Complemental strand, 17919919 - 17919868
Alignment:
| Q |
332 |
aaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
17919919 |
aaaatgtcgatattgttaggccggatgccatgaccggggttcgaacctcggt |
17919868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 358
Target Start/End: Original strand, 40216783 - 40216830
Alignment:
| Q |
313 |
aagtcctagctcaactggc-aaaatgccg-aaattgttaggccggatg |
358 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
40216783 |
aagtcctagctcaactggcaaaaatgccgaaaattgttaggccggatg |
40216830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 376
Target Start/End: Original strand, 43330622 - 43330684
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaac |
376 |
Q |
| |
|
|||||||| |||||||| ||||||||| ||||||||||||| || |||||| ||||||||||| |
|
|
| T |
43330622 |
aagtcctaactcaactg-caaaatgccaaaattgttaggccagacaccatgatcgggttcgaac |
43330684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 313 - 377
Target Start/End: Original strand, 5917286 - 5917352
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaacc |
377 |
Q |
| |
|
||||||||| ||||||| ||||| || ||||| |||||||||||||| ||||||| ||||||||||| |
|
|
| T |
5917286 |
aagtcctagttcaactgacaaaaatgtcgaaactgttaggccggatgtcatgaccagggttcgaacc |
5917352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 316 - 369
Target Start/End: Complemental strand, 25899303 - 25899249
Alignment:
| Q |
316 |
tcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||| |||||||| ||||| ||||||||||||||||||||| | |||||||||| |
|
|
| T |
25899303 |
tcctaactcaactgacaaaaatgccgaaattgttaggccggacgtcatgaccggg |
25899249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 320 - 358
Target Start/End: Complemental strand, 35497752 - 35497714
Alignment:
| Q |
320 |
agctcaactggcaaaatgccgaaattgttaggccggatg |
358 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
35497752 |
agctcaactggtaaaatgccaaaattgttaggccggatg |
35497714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 311 - 365
Target Start/End: Original strand, 39303313 - 39303366
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | |||||| |
|
|
| T |
39303313 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgac |
39303366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 332 - 369
Target Start/End: Complemental strand, 10926190 - 10926153
Alignment:
| Q |
332 |
aaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
10926190 |
aaaatgccgaaattgttaggtcggatgctatgaccggg |
10926153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 307 - 356
Target Start/End: Complemental strand, 24420116 - 24420067
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||| |||||||| ||||| |||||||||| |||||||||||| ||||| |
|
|
| T |
24420116 |
atccacaagtcctaactcaattggcaaaatgtcgaaattgttagaccgga |
24420067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 313 - 380
Target Start/End: Complemental strand, 28183835 - 28183766
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||| ||||||||||| ||||| |||||||||| ||||||||||| | ||||| |||||||||||||| |
|
|
| T |
28183835 |
aagtcttagctcaactgacaaaaatgccgaaattattaggccggatttcttgaccggggttcgaaccccg |
28183766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 28817260 - 28817304
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
28817260 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga |
28817304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 32333118 - 32333162
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
32333118 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga |
32333162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 313 - 380
Target Start/End: Original strand, 40418132 - 40418201
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
|||| ||||||||||||| |||| ||| |||||||||||||| || | ||||||||| |||||||||||| |
|
|
| T |
40418132 |
aagttctagctcaactggtaaaaatgctgaaattgttaggccagacgtcatgaccggagttcgaaccccg |
40418201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 70647 - 70580
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| |||| | ||||| ||||||| |||||| |
|
|
| T |
70647 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggtcggacgtcatgacccgggtttgaaccc |
70580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 4531106 - 4531039
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| |||| ||| | ||||| |||||||||||||| |
|
|
| T |
4531106 |
agaagtcctagctcaattggc-aaatgccgaaattgcaaggctggacgtcatgacccgggttcgaaccc |
4531039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 315 - 382
Target Start/End: Complemental strand, 12927347 - 12927279
Alignment:
| Q |
315 |
gtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||||| ||||||||||| |||||||||| |||| | ||||||| | |||||||||| ||||| |
|
|
| T |
12927347 |
gtcctaactcaattggcaaaatgctgaaattgttatgccgtacgccatgatcagggttcgaactccggt |
12927279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 347 - 382
Target Start/End: Original strand, 36055508 - 36055544
Alignment:
| Q |
347 |
ttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36055508 |
ttaggccggatgccatgaccggggttcgaaccccggt |
36055544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 332 - 368
Target Start/End: Complemental strand, 36442791 - 36442755
Alignment:
| Q |
332 |
aaaatgccgaaattgttaggccggatgccatgaccgg |
368 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
36442791 |
aaaatgccgaaattgttaggccggacgtcatgaccgg |
36442755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: scaffold0432
Description:
Target: scaffold0432; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 307 - 385
Target Start/End: Original strand, 9366 - 9445
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9366 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcc |
9445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 72; Significance: 1e-32; HSPs: 106)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 307 - 385
Target Start/End: Original strand, 32023251 - 32023330
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32023251 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcc |
32023330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 35476620 - 35476543
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35476620 |
tatccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
35476543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 38490530 - 38490453
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38490530 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccccggt |
38490453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 12236120 - 12236196
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12236120 |
atccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
12236196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 15897213 - 15897289
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
15897213 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
15897289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 20251614 - 20251538
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
20251614 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt |
20251538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 23080227 - 23080151
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
23080227 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
23080151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 34667043 - 34667119
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
34667043 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggagttcgaaccccggt |
34667119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 36754870 - 36754794
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
36754870 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggt |
36754794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 308 - 382
Target Start/End: Original strand, 39070019 - 39070094
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39070019 |
tccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
39070094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 7975144 - 7975067
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
7975144 |
tatccacaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggt |
7975067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 13268105 - 13268028
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
13268105 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt |
13268028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 34481797 - 34481724
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
34481797 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggt |
34481724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 40592311 - 40592388
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
40592311 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaatcccggt |
40592388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 42007345 - 42007268
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42007345 |
tatccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
42007268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 2287438 - 2287362
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
2287438 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccccggt |
2287362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 6731541 - 6731617
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
6731541 |
atccagaagtcctagctcaactagcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
6731617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 10392644 - 10392720
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10392644 |
atccagaagtcctagctcaactggtaaaatgccgacattgttaggccggatgccatgaccggagttcgaaccccggt |
10392720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 42160386 - 42160310
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
42160386 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggt |
42160310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 33607041 - 33607116
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
33607041 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccagatgccatgactggggttcgaaccccg |
33607116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 43461460 - 43461387
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43461460 |
cagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
43461387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 44948017 - 44948094
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
44948017 |
tatccagaagtcctagctcaactgacaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaactccggt |
44948094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 4014944 - 4014866
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
4014944 |
atatccacaagtcctagctcaactgacaaaatgccgaaattgttaggccggatctcatgaccggggttcgaaccccggt |
4014866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 7958113 - 7958051
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
7958113 |
atccagaagtcctagctcaactggcaaaataccgaaattgttgggccggatgccatgaccggg |
7958051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 42200993 - 42200915
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| | ||||||||||| |||| |
|
|
| T |
42200993 |
atatccagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgtcatgatcggggttcgaacctcggt |
42200915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 727419 - 727342
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| | |||||||||| ||||| |
|
|
| T |
727419 |
tatccagaagtcctagctcaactgacaaaatgccgaaattgttaggtcggatgccatgatcggggttcgaactccggt |
727342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 23497642 - 23497565
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||||||| | ||||| |||||||||||||||| |
|
|
| T |
23497642 |
tatccagaagtcctagttcaactggtaaaatgccgaaattgttaggccggatgtcgtgaccggggttcgaaccccggt |
23497565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 23957050 - 23957127
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
23957050 |
tatccagaagttctagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggt |
23957127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 43035438 - 43035515
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
43035438 |
tatccagaagtcctagctcaattggcaaaataccgaaattgttaggccggatgtcatgatcggggttcgaaccccggt |
43035515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 45049383 - 45049460
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||| |||||| |
|
|
| T |
45049383 |
tatccagaagtcttagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggt |
45049460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 3048541 - 3048617
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
3048541 |
atccataagtcctagctcaactagcaaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccccggt |
3048617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 24381248 - 24381320
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
24381248 |
agaagtcctagctcaactagcaaaatgtcgaaattgttaggctggatgccatgaccggggttcgaaccccggt |
24381320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 35687915 - 35687839
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| ||||||| ||||| |
|
|
| T |
35687915 |
atccagaagtcctagctcaactgataaaatgccgaaattgttaggccggatgccatgatcgggattcgaactccggt |
35687839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 40812016 - 40812092
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
40812016 |
atccagaagtcctacctcaactgacaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt |
40812092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 4772302 - 4772364
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4772302 |
atccataagtcatagctcaactggcaaaatgctgaaattgttaggccggatgccatgaccggg |
4772364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 306 - 379
Target Start/End: Complemental strand, 41164778 - 41164704
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
41164778 |
tatccagaagtcctagctcaactggcaaagtgtcgaaattgttaggccggatatcatgaccggggttcgaacccc |
41164704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 18368792 - 18368869
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||| | |||||||||||||||| |
|
|
| T |
18368792 |
tatctagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatatcatgatcggggttcgaaccccggt |
18368869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 18999327 - 18999404
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| | || |||||||||||||| |
|
|
| T |
18999327 |
tatccagaagtcctaactcaactggcaaaatgccgaaattgttaggtcggatgccattattggagttcgaaccccggt |
18999404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 28855544 - 28855467
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
28855544 |
tatccggaagtcctagctcaactggcaaaatgccaaaattgttagggcggatgccatgactggggttcgaatcccggt |
28855467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 321 - 380
Target Start/End: Original strand, 41196976 - 41197036
Alignment:
| Q |
321 |
gctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
41196976 |
gctcaactggcaaaatgccgaaattgttaagccggatgccatgaccggggttcgaaccccg |
41197036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 31054046 - 31054109
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||| |
|
|
| T |
31054046 |
tatccagaggtcctagctcaactggcaaaatgtcgatattgttaggccggatgccaagaccggg |
31054109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 307 - 377
Target Start/End: Original strand, 35706851 - 35706922
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaacc |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||| ||||||||||| |
|
|
| T |
35706851 |
atccagaagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgtcatgactggggttcgaacc |
35706922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 11543926 - 11543852
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||||||||| | ||||| |||||||||| |
|
|
| T |
11543926 |
cagaagtcctagctcaactggcaaaaatgccgaaattgttaggtcggatgccatgatcggggtttgaaccccggt |
11543852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 15488747 - 15488820
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccc |
378 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
15488747 |
tatctagaagtcctagctcaactaataaaatgccgaaattgttaggccggatgtcatgaccggagttcgaaccc |
15488820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 16535073 - 16534996
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| |||||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
16535073 |
tatccagaagtcctagttcaactgataaaatgtcgaaattgttaggccggatgtcatgatcggagttcgaaccccggt |
16534996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 23458678 - 23458755
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||| |||||||| ||||||||| ||||||| ||||||||||||| |||| |||||||| |||||||||||||||| |
|
|
| T |
23458678 |
tatccacaagtcctaactcaactggaaaaatgctgaaattgttaggctggataccatgaccggggttcgaaccccggt |
23458755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 323 - 378
Target Start/End: Complemental strand, 15920727 - 15920671
Alignment:
| Q |
323 |
tcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
15920727 |
tcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
15920671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 16010742 - 16010666
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||| ||||||| | |||| | |||||||||||||||| |
|
|
| T |
16010742 |
atccagaagtcgtagctcaactggcaaaatgtcgaaattgttaagccggatactatgatcggggttcgaaccccggt |
16010666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 32120613 - 32120680
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||||| | |||||||||||| |
|
|
| T |
32120613 |
agaagtcctagctcaactggcaaaatg-cgaaattgttaggccggataccatgatcggggttcgaaccc |
32120680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 34242576 - 34242504
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
34242576 |
agaagtcctagctcaactgataaaatgccgaaattgttaggccggatatcatgatcggggttcgaaccccggt |
34242504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 36794803 - 36794879
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| |||||| | |||||||||||||| ||||||||| | ||||||||||| |||| |
|
|
| T |
36794803 |
atccagaagtcctagctcaactggtaaaatgtcaaaattgttaggccgaatgccatgatcggggttcgaacctcggt |
36794879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 310 - 369
Target Start/End: Complemental strand, 16368814 - 16368755
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||||| ||||| |||| |
|
|
| T |
16368814 |
cagaagtcctagctcatctggcaaaataccgaaattgttaggccggatgtcatgatcggg |
16368755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 310 - 380
Target Start/End: Original strand, 38463141 - 38463212
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |||||| |||| | |||||||||||||| |
|
|
| T |
38463141 |
cagaagtcttagctcaactggcaaaatgccgaaattgttaggtcggatgttatgatcggggttcgaaccccg |
38463212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 310 - 365
Target Start/End: Complemental strand, 42133568 - 42133513
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42133568 |
cagaagtcttagttcaactggcaaaatgccgaaattgttaggtcggatgccatgac |
42133513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 42211276 - 42211351
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccg |
380 |
Q |
| |
|
|||||||||||| ||| |||||||| |||||| |||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
42211276 |
tatccagaagtcttagttcaactggtaaaatgtcgaaattgttaggccgcatgctatgaccgggattcgaaccccg |
42211351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 42414529 - 42414580
Alignment:
| Q |
332 |
aaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42414529 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
42414580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 305 - 359
Target Start/End: Complemental strand, 11816907 - 11816853
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgc |
359 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||| ||||||||||||||||||||| |
|
|
| T |
11816907 |
atatccagaagtcctagctcaattggtaaaatgtcgaaattgttaggccggatgc |
11816853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 31516336 - 31516258
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||| |||||||| ||||||||| ||||||||||||||||||||||||| |||||| | ||||||||||| |||| |
|
|
| T |
31516336 |
atatccacaagtcctaactcaactggaaaaatgccgaaattgttaggccggaaaccatgatcagggttcgaacctcggt |
31516258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 38140696 - 38140766
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||| |||||||| ||||| | |||||||||||||||| |
|
|
| T |
38140696 |
aagtcctaactcaactggtaaaatgccgaaattgttaagccggatgtcatgatcggggttcgaaccccggt |
38140766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 303 - 360
Target Start/End: Original strand, 433133 - 433190
Alignment:
| Q |
303 |
acatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgcc |
360 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
433133 |
acatatccagaagtcctaactcaactgacaaaatgtcgaaattgttaggctggatgcc |
433190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 305 - 381
Target Start/End: Original strand, 11061380 - 11061456
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccgg |
381 |
Q |
| |
|
|||| ||||||||||| |||||||| |||||| |||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
11061380 |
atattcagaagtcctaactcaactgataaaatgtcgaaattgttaggccggatg-catgaccggggttcgaaccccgg |
11061456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 366
Target Start/End: Complemental strand, 7607370 - 7607310
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc |
366 |
Q |
| |
|
|||||||||||||||||||| || ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
7607370 |
atccagaagtcctagctcaattgacaaaaatgtcgaaattgttaggccggatgccatgacc |
7607310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 19048758 - 19048825
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
19048758 |
agaagtcctagctcaactggc-aaatgccgaaattgtaaggccggacgtcatgatccgggttcgaaccc |
19048825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 19134647 - 19134571
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
|||||| |||||||||||||||||| |||| || ||||||||||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
19134647 |
tatccataagtcctagctcaactggaaaaaatgtcgaaattgttaggccagatgccgtgaccggagttcgaaccccg |
19134571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 305 - 380
Target Start/End: Complemental strand, 31525083 - 31525007
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
||||||| |||| |||||||||||| ||||||||||||||||||| |||| | |||||||||| |||||||||||| |
|
|
| T |
31525083 |
atatccacaagttctagctcaactgacaaaatgccgaaattgttatgccgaaaaccatgaccggagttcgaaccccg |
31525007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 39218680 - 39218756
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||||||||||||| |||||| |||| | |||||||||||||||| |
|
|
| T |
39218680 |
atccagaagtcctagctcaattcgaaaaatgccgaaattgttaggtcggatgttatgatcggggttcgaaccccggt |
39218756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 314 - 379
Target Start/End: Complemental strand, 12221267 - 12221200
Alignment:
| Q |
314 |
agtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
12221267 |
agtcctagctcaactggcaaaaatgatgaaattgttaggccggacgccatgaccagggttcgaacccc |
12221200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 8859416 - 8859342
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
|||||||||| |||| |||||| |||||||| |||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
8859416 |
atccagaagttctagttcaactagcaaaatgtcgaaattgttaggccggatgtcatgattggggttcgaaccccg |
8859342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 313 - 367
Target Start/End: Original strand, 31819643 - 31819697
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg |
367 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
31819643 |
aagtcctaactcaactggcaaaatgtcgaaattattaggccggatggcatgaccg |
31819697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 315 - 376
Target Start/End: Original strand, 39417449 - 39417511
Alignment:
| Q |
315 |
gtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccgggttcgaac |
376 |
Q |
| |
|
||||||||||||||| ||||| | ||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
39417449 |
gtcctagctcaactgacaaaaataccgaaattgttaggccggatgtcatgacggggttcgaac |
39417511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 379
Target Start/End: Complemental strand, 4695121 - 4695048
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
|||||||| |||||||| ||||||||||||| |||||||||| || |||||| ||||| | ||||||||||||| |
|
|
| T |
4695121 |
atccagaaatcctagcttaactggcaaaatgtcgaaattgttcggtcggatgtcatgatcagggttcgaacccc |
4695048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 379
Target Start/End: Original strand, 11011975 - 11012047
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaacccc |
379 |
Q |
| |
|
||||| |||||||||||||||| ||||| ||| ||||||||||||| ||||||||||| ||| ||||||||||| |
|
|
| T |
11011975 |
atccacaagtcctagctcaactagcaaa-tgctgaaattgttaggctggatgccatgatcggagttcgaacccc |
11012047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 25510427 - 25510382
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
25510427 |
agaagtcctagctcaactggtaaaataccgaaattgttaggccgga |
25510382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 39310368 - 39310441
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||| |||| | |||||||||| ||||| |
|
|
| T |
39310368 |
cagaagtcctagctcaactagcaaaatatcgaaattgttaggccggatgttatgatcggggttcgaactccggt |
39310441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 10639730 - 10639663
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
10639730 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
10639663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 18779914 - 18779986
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| |||| ||| |||||| ||||||||||||| |||||||||||||| || |||||||| |||| |
|
|
| T |
18779914 |
agaagtcctagttcaattggtaaaatgtcgaaattgttaggtcggatgccatgaccaggcttcgaaccacggt |
18779986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 33083678 - 33083611
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
33083678 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
33083611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 313 - 379
Target Start/End: Original strand, 16178264 - 16178331
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||| ||||||| | ||||||||||||| |
|
|
| T |
16178264 |
aagtcctagctcaactgaaaaaatgccgaaattgttaggtaggacgccatgatcggggttcgaacccc |
16178331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 337 - 382
Target Start/End: Original strand, 8532135 - 8532181
Alignment:
| Q |
337 |
gccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
8532135 |
gccgaaattgttaggccggatgctatgaccggggttcgaaccccggt |
8532181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 12541467 - 12541389
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||| |||| |||| |||||||| ||||| |||||||||||||| |||||| ||||| | ||||||||||| |||| |
|
|
| T |
12541467 |
atatccacaagtactaggtcaactggtaaaataccgaaattgttaggtcggatgtcatgatcggggttcgaacctcggt |
12541389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 18469560 - 18469514
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccg |
354 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
18469560 |
tccataagtcctagctcaactggctaaatgtcgaaattgttaggccg |
18469514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 306 - 376
Target Start/End: Original strand, 5887569 - 5887637
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaac |
376 |
Q |
| |
|
||||||||||||||| ||||||||| |||||| | |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
5887569 |
tatccagaagtcctaactcaactggtaaaatgtc---attgttaggccggatgtcatgaccagggttcgaac |
5887637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 11708682 - 11708726
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
11708682 |
agaagtcctagctcaactggc-aaatgccgaaattgtaaggccgga |
11708726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 306 - 378
Target Start/End: Complemental strand, 12847085 - 12847012
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||| ||| ||||||||| ||||| || |||||||||||| ||||| ||||| | |||||||||||| |
|
|
| T |
12847085 |
tatccagaagttctaactcaactggtaaaataccaaaattgttaggctggatgtcatgatcagggttcgaaccc |
12847012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 336 - 380
Target Start/End: Original strand, 13622983 - 13623028
Alignment:
| Q |
336 |
tgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
13622983 |
tgccgaaattgttaggccggatgccgtgaccggagttcgaaccccg |
13623028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 313 - 354
Target Start/End: Original strand, 19967739 - 19967780
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccg |
354 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
19967739 |
aagtcctagctcaactggcaaaataccgaaattgttaagccg |
19967780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 322 - 382
Target Start/End: Complemental strand, 37198845 - 37198784
Alignment:
| Q |
322 |
ctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| |||| ||||| | |||||||||||||||| |
|
|
| T |
37198845 |
ctcaactgacaaaatgtcgaaattgttaggccagatggcatgatcggggttcgaaccccggt |
37198784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 332 - 380
Target Start/End: Complemental strand, 37644337 - 37644288
Alignment:
| Q |
332 |
aaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
37644337 |
aaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccccg |
37644288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 307 - 364
Target Start/End: Original strand, 42030243 - 42030299
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||||||| |||||| ||||| |
|
|
| T |
42030243 |
atccagaagtcctagctcaac-ggtaaaatgtcgaaattgttaggtcggatgtcatga |
42030299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 45125289 - 45125245
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
45125289 |
agaagtcctagctcaactggc-aaatgccgaaattgtaaggccgga |
45125245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 11459719 - 11459786
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| |||| | ||||| |||||||||||||| |
|
|
| T |
11459719 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggtcggacgtcatgacccgggttcgaaccc |
11459786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 351
Target Start/End: Complemental strand, 29741087 - 29741043
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttagg |
351 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||| ||||| |
|
|
| T |
29741087 |
atccagaagtcctagctcaactggaaaaatgtcgaaattattagg |
29741043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 499887 - 499824
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||| ||||||| |||| |||||||| |||||||||||||||| | |||||||||| |||| |
|
|
| T |
499887 |
atccagacgtcctagttcaattggcaaaaatgccgaaattgttaggtcagatgccatgatcggg |
499824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 364
Target Start/End: Complemental strand, 7315884 - 7315833
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||| |||||| |||||| |
|
|
| T |
7315884 |
aagtcctagctcaactaacaaaatgctgaaattgttagaccggataccatga |
7315833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 308 - 378
Target Start/End: Complemental strand, 11816678 - 11816608
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||| |||| | | ||||| |||||||||||| |
|
|
| T |
11816678 |
tccagaagtcctagctcaactggc-aaatgccgaaattgcaaggtcggacgtcgtgacctgggttcgaaccc |
11816608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 313 - 377
Target Start/End: Original strand, 13491030 - 13491096
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaacc |
377 |
Q |
| |
|
||||| ||||||||||||||||| | |||||||||||| |||||| | ||||||| ||||||||||| |
|
|
| T |
13491030 |
aagtcatagctcaactggcaaaaataccgaaattgttatgccggacgtcatgaccggggttcgaacc |
13491096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 320 - 369
Target Start/End: Original strand, 33898242 - 33898292
Alignment:
| Q |
320 |
agctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||| |||||||| || |||||||||||||||||||| |||||||||| |
|
|
| T |
33898242 |
agctcaattggcaaaaatgtcgaaattgttaggccggatgtcatgaccggg |
33898292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 358
Target Start/End: Original strand, 43696410 - 43696460
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg |
358 |
Q |
| |
|
|||| ||||| ||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
43696410 |
tccacaagtcttagctcaactgaaaaaatgccgaaattattaggccggatg |
43696460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 320 - 369
Target Start/End: Complemental strand, 11091702 - 11091653
Alignment:
| Q |
320 |
agctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||| |||||||||||||||||||||| | |||| ||||| |||| |
|
|
| T |
11091702 |
agctcaactagcaaaatgccgaaattgttaggtcagatgtcatgatcggg |
11091653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 306 - 377
Target Start/End: Original strand, 18055856 - 18055929
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacc |
377 |
Q |
| |
|
|||||| |||||||||||||| |||| |||||| | |||||| ||||||||||| ||||| | ||||||||||| |
|
|
| T |
18055856 |
tatccataagtcctagctcaattggcaaaaatgtcaaaattgctaggccggatgtcatgatcggggttcgaacc |
18055929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 26605628 - 26605672
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
26605628 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga |
26605672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 313 - 377
Target Start/End: Complemental strand, 39831565 - 39831501
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacc |
377 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| |||||||| | ||||| ||||||||||||| |
|
|
| T |
39831565 |
aagtcctagctcaactggc-aaataccgaaattgcaaggccggacgtcatgatccgggttcgaacc |
39831501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 318 - 363
Target Start/End: Original strand, 44887134 - 44887179
Alignment:
| Q |
318 |
ctagctcaactggcaaaatgccgaaattgttaggccggatgccatg |
363 |
Q |
| |
|
|||| ||||||||||||||| |||||||||| ||||||||| |||| |
|
|
| T |
44887134 |
ctagttcaactggcaaaatgtcgaaattgttgggccggatgtcatg |
44887179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 7276011 - 7275943
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccat-gaccgggttcgaaccc |
378 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| ||| |||||| | | | |||||||||||||| |
|
|
| T |
7276011 |
agaagtcctaactcaactgacaaaatgccgaaattgcaaggtcggatgtcgtggcccgggttcgaaccc |
7275943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 305 - 349
Target Start/End: Complemental strand, 21840579 - 21840536
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgtta |
349 |
Q |
| |
|
||||||||||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
21840579 |
atatccagaagtcctagctcaactgac-aaatgtcgaaattgtta |
21840536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 356
Target Start/End: Complemental strand, 25501910 - 25501863
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||| |||||||| |
|
|
| T |
25501910 |
tccagaagtcctagctcaactggc-aaatgctgaaattgcaaggccgga |
25501863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0402 (Bit Score: 71; Significance: 5e-32; HSPs: 1)
Name: scaffold0402
Description:
Target: scaffold0402; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 1372 - 1294
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1372 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
1294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 71; Significance: 5e-32; HSPs: 145)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 8381076 - 8381154
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8381076 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
8381154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 13525167 - 13525244
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13525167 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
13525244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 4232306 - 4232230
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4232306 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
4232230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 4833238 - 4833162
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4833238 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
4833162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 307 - 385
Target Start/End: Complemental strand, 6583364 - 6583285
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggtgcc |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
6583364 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtgcc |
6583285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 29212196 - 29212118
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29212196 |
atatccataagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
29212118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 4976838 - 4976761
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4976838 |
tatccagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccccggt |
4976761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 6083272 - 6083195
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
6083272 |
atatccagaagtcctagctcaactagcaaaatgccgaaattgttaggccggataccatgaccgggttcgaactccggt |
6083195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 24650677 - 24650600
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24650677 |
tatccagaagtcctacctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
24650600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 3917765 - 3917841
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
3917765 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
3917841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 306 - 385
Target Start/End: Original strand, 24250723 - 24250803
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc |
385 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
24250723 |
tatccagaagtcctagctcaattggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtgcc |
24250803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 32961107 - 32961031
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
32961107 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccccggt |
32961031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 30553098 - 30553023
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
30553098 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttagaccggatgccatgaccggagttcgaaccccg |
30553023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 306 - 379
Target Start/End: Original strand, 41464662 - 41464736
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
41464662 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaacccc |
41464736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 381
Target Start/End: Complemental strand, 28171110 - 28171033
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccgg |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28171110 |
tatccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccgg |
28171033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 11312593 - 11312665
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
11312593 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggt |
11312665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 27396853 - 27396925
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27396853 |
atccagaagtcctagctcaactgacaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
27396925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 306 - 385
Target Start/End: Original strand, 28266524 - 28266604
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc |
385 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||| |||||||| |
|
|
| T |
28266524 |
tatccagaagtcctagctcaactgacaaaatgccgaaattgttaggctggatgccatgaccggggttcgaactccggtgcc |
28266604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 38127971 - 38127895
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
38127971 |
atccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggt |
38127895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 43605705 - 43605629
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43605705 |
atccagaagtcctagctcaactggcaaaatgctgaatttgttaggccggatgccatgaccggggttcgaaccccggt |
43605629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 43898092 - 43898016
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43898092 |
atccagaagtcctagctcaacagacaaaatgccgaaattgttaggccggatgccatgaccgggattcgaaccccggt |
43898016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 305 - 369
Target Start/End: Complemental strand, 46838858 - 46838794
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46838858 |
atatccagaagtcctagctcaactggaaaaatgccgaaattgttaggccggatgccatgaccggg |
46838794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 54097569 - 54097493
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
54097569 |
atccagaagtcctagctcaaatggcaaaatgccgaaattgttaggccggatgccatgaccggggttggaaccccggt |
54097493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 307 - 377
Target Start/End: Original strand, 22371449 - 22371520
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacc |
377 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22371449 |
atccagaagtcctacctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaacc |
22371520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 304 - 382
Target Start/End: Original strand, 35069309 - 35069388
Alignment:
| Q |
304 |
catatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35069309 |
catatcaagaagtcttagttcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
35069388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 10474037 - 10473967
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10474037 |
aagtcctagctcaactggcaaaatgctgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
10473967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 47069004 - 47069082
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47069004 |
tatccagaagtcttagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
47069082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 2687557 - 2687630
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||| |
|
|
| T |
2687557 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatggcatgatcggggttcgaaccc |
2687630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 2789108 - 2789031
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
2789108 |
tatccagaagtcctagttcaactggcaaaatgccgaaattattaggcctgatgccatgaccggggttcgaaccccggt |
2789031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 40840171 - 40840244
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40840171 |
agaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
40840244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 1242220 - 1242292
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||||| |
|
|
| T |
1242220 |
agaagtcctagctcaactggcaaaatgccgaaattattaggccggatgccatgatcggggttcgaaccccggt |
1242292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 27002869 - 27002793
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| | |||||||||||||| |
|
|
| T |
27002869 |
atccagaagtcctagctcaactggcaaagtgccgaaattgttaagccggatgccatgaccagagttcgaaccccggt |
27002793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 305 - 380
Target Start/End: Original strand, 34397677 - 34397753
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
34397677 |
atatccagaagtcctagttcaactggcaaaatgccgaaattgttaggccggatgtcataaccggggttcgaaccccg |
34397753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 35359716 - 35359792
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35359716 |
atccagaagtcttaattcaactggcaaaatgccgaaattgttaggccggatgccatgaccagggttcgaaccccggt |
35359792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 15003625 - 15003703
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
15003625 |
atatccagaagtcctagttcaactggcaaaatgccaaaattgttaggtcggatgtcatgaccggggttcgaaccccggt |
15003703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 17500926 - 17500988
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17500926 |
atccagaagtcctaactcaactggaaaaatgccgaaattgttaggccggatgccatgaccggg |
17500988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 32590969 - 32591047
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| | ||||||||| |||||| |
|
|
| T |
32590969 |
atatccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgatcggggttcgaatcccggt |
32591047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 42296709 - 42296786
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
42296709 |
atatccagaagtcctagctcaactg-caaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
42296786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 307 - 380
Target Start/End: Original strand, 46894812 - 46894886
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46894812 |
atccagaagtcctagctcaactgacaaaatatcgaaattgttaggccggatgccatgaccgaggttcgaaccccg |
46894886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 53583960 - 53584022
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
53583960 |
atccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggattccatgaccggg |
53584022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 8507930 - 8508007
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
8507930 |
tatccagaagtcttagctcaactggaaaaatgccgaaattgttaggccggatgccatgactggggttcaaaccccggt |
8508007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 11029662 - 11029739
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
11029662 |
atccagaagtcctagctcaactggcaaaaatgtcgaaattgttaggctggatgccatgaccagggttcgaaccccggt |
11029739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 11751210 - 11751287
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
11751210 |
atccataagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatcaccggggttcgaaccccggt |
11751287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 24910418 - 24910341
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| | |||||||||||||||| |
|
|
| T |
24910418 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggctggatatcatgatcggggttcgaaccccggt |
24910341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 25118836 - 25118759
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||| ||||||| |||||||||| |||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25118836 |
tatctagaagtcttagctcaactagcaaaatgtcgaaattgttaggccggatgccatgaccagggttcgaaccccggt |
25118759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 24657410 - 24657486
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||| |||||||||| || |||||||||||||||| |
|
|
| T |
24657410 |
atccagaagtcctaactcaactgacaaaatgccgaaattgttaggcaggatgccatggccagggttcgaaccccggt |
24657486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 24751752 - 24751824
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||| |
|
|
| T |
24751752 |
atccacaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccc |
24751824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 37124215 - 37124291
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
37124215 |
atccagaagtcatagctctactggcaaaatgccgaaattgttaggccgaatgccatgaccggggttcgaacctcggt |
37124291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 44107379 - 44107455
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||| |||| |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
44107379 |
tatccacaagttctagctcaactggcaaaatgttgaaattgttaggccggatgccatgaccggggtcgaacctcggt |
44107455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 47410881 - 47410809
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
47410881 |
atccagaagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgtcatgaccggggttcgaaccc |
47410809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 10047870 - 10047933
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10047870 |
tatccagaagtcctagctcaattggtaaaatgccgaaattgttatgccggatgccatgaccggg |
10047933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 380
Target Start/End: Original strand, 12948812 - 12948883
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
12948812 |
cagaagtcctagctcaactggtaaaatgacgaaattgttaggccggatgccatgatcggggttcgaaccccg |
12948883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 306 - 379
Target Start/End: Complemental strand, 19921442 - 19921368
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaacccc |
379 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||| | |||||||||||| |
|
|
| T |
19921442 |
tatccagaagtcctagctcaattggcaaaatgctgaaattgttaggtcggatgccatgactgaggttcgaacccc |
19921368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 305 - 378
Target Start/End: Complemental strand, 40193087 - 40193013
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||| |||||| |||||| |||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
40193087 |
atatccagaagtcctagcttaactggtaaaatgtcgaaattgttaggccggatgccatgatcggagttcgaaccc |
40193013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 319 - 382
Target Start/End: Original strand, 3440736 - 3440801
Alignment:
| Q |
319 |
tagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3440736 |
tagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
3440801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 307 - 364
Target Start/End: Original strand, 47408839 - 47408896
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
47408839 |
atccagaagtcctagctcaactagcaaaatgccgaaattgttaggccggataccatga |
47408896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 50238966 - 50238893
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||| ||| |||||||| ||||| |
|
|
| T |
50238966 |
cagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgatcggagttcgaactccggt |
50238893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 10228956 - 10229032
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| || |||||||||||||||||| |||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
10228956 |
atccagaagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggt |
10229032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 14868983 - 14868908
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |||| |||||||| ||||| |||||||||| |
|
|
| T |
14868983 |
atccagaagtcctagctcaactggcaaa-tgccgaaattgttaggctggataccatgaccggggtttgaaccccggt |
14868908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 305 - 365
Target Start/End: Complemental strand, 24274011 - 24273951
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
||||| |||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24274011 |
atatctagaagtcctaactcaactgacaaaatgccgaaattgttaggccggatgccatgac |
24273951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 44037573 - 44037497
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||| || |||||||| |||||| |
|
|
| T |
44037573 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcgtgatcgaggttcgaatcccggt |
44037497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 310 - 378
Target Start/End: Complemental strand, 46311569 - 46311502
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
46311569 |
cagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgctatgacc-ggttcgaaccc |
46311502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 53669836 - 53669764
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||||||||||||| ||||||| |||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
53669836 |
agaagttctagctcaactggtaaaatgctgaaattgttaggccggatgccatgactggagttcgaaccccggt |
53669764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 331 - 385
Target Start/End: Original strand, 9609955 - 9610010
Alignment:
| Q |
331 |
caaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9609955 |
caaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcc |
9610010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 369
Target Start/End: Original strand, 48191096 - 48191155
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48191096 |
cagaagtcctagctcaactgctaaaatgccgaaattgttaggccggatgtcatgaccggg |
48191155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 325 - 382
Target Start/End: Complemental strand, 28197095 - 28197037
Alignment:
| Q |
325 |
aactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
28197095 |
aactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
28197037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 8826623 - 8826700
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||| |||||||| |||| | ||| |||||||||||| |
|
|
| T |
8826623 |
tatccagaagtcctagctcaacggacaaaatgccgaaattgttagaccggatgctatgatcggggctcgaaccccggt |
8826700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 319 - 382
Target Start/End: Complemental strand, 1218488 - 1218424
Alignment:
| Q |
319 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||| |||| |
|
|
| T |
1218488 |
tagctcaactggtaaaatgccgaaattgttaggccggatgccatgatcggggttcgaacctcggt |
1218424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 367
Target Start/End: Original strand, 2900254 - 2900314
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg |
367 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||| ||| |||| |
|
|
| T |
2900254 |
atccagaagtcctagctccactggcaaaatgccgaaattgttaagccggatgtcataaccg |
2900314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 11249959 - 11250031
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| |||||||||||| |||||||||||| | |||||||||||| |
|
|
| T |
11249959 |
atccacaagtcctagctcaactggtaaaatgcagaaattgttaggtcggatgccatgatcggggttcgaaccc |
11250031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 371
Target Start/End: Original strand, 18271576 - 18271640
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggtt |
371 |
Q |
| |
|
|||||||||| ||| |||||||| ||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
18271576 |
atccagaagttctaactcaactgacaaaatgccgaaattgttaggtcggatgccatgatcgggtt |
18271640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 380
Target Start/End: Original strand, 23878943 - 23879019
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||| ||||||||||||| |||| |||||| || |||||||||||| |
|
|
| T |
23878943 |
atatccacaagtcctagctcaactggaaaaatgcctaaattgttaggccagatgtcatgactggagttcgaaccccg |
23879019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 308 - 379
Target Start/End: Original strand, 37312528 - 37312600
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaacccc |
379 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
37312528 |
tccagaagtcctagctcaactggtaaaataccgaaattgttaggccggacgccttgacgggggttcgaacccc |
37312600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 369
Target Start/End: Original strand, 40559671 - 40559735
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |||||||| ||| |||| |
|
|
| T |
40559671 |
atatccagaagtcctagctcaactgataaaatgccgaaattgttaggtcggatgccttgatcggg |
40559735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 48555835 - 48555911
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||| |||||||||||||||||| ||||||||||||| ||||| ||| || |||||||||||||||| |
|
|
| T |
48555835 |
atccataagtcctacctcaactggcaaaatgccaaaattgttaggccagatgctatggccggggttcgaaccccggt |
48555911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 310 - 385
Target Start/End: Complemental strand, 51112589 - 51112514
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc |
385 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||| | ||||||| ||||||||||||| ||||| |
|
|
| T |
51112589 |
cagaagtcctagctcaactggcaaa-tgccgaaattgctaggccggacgtcatgaccggggttcgaaccccagtgcc |
51112514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 9583553 - 9583490
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||| | ||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
9583553 |
atccagaagccttagctcaactggcaaaaatgccgaaattgttaggccggatgctatgaccggg |
9583490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 44879358 - 44879287
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||| |||| |||||||||| | ||||||||| |
|
|
| T |
44879358 |
agaagtcctagttcaactggcaaaatgtcgaaattgttaggccagatgtcatgaccggggttcaaccccggt |
44879287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 8792860 - 8792782
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||| || |||| ||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
8792860 |
tatccagaagtcctagctcaaccggtaaaaatgccgaaattgttaggctggatgccatgattggggttcgaaccccggt |
8792782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 349
Target Start/End: Complemental strand, 21402787 - 21402745
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgtta |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21402787 |
atccagaagtcctagctcaactggcaaaatgccgaaattgtta |
21402745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 28731844 - 28731922
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||| |||||||||||| ||||||| ||||||||||||| |||||||||||| | ||||||||| |||||| |
|
|
| T |
28731844 |
atatctagaagttctagctcaactgacaaaatgtcgaaattgttaggtcggatgccatgatcggggttcgaatcccggt |
28731922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 310 - 364
Target Start/End: Original strand, 41921508 - 41921562
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |||| ||||| |
|
|
| T |
41921508 |
cagaagtcctagctcaactggtaaaatgccgaaattgttaggccagatgtcatga |
41921562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 12088412 - 12088335
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||| ||||||||||||||||||||| |||| | |||||||||||||||| |
|
|
| T |
12088412 |
tatccagaagtcctagatcacttggaaaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggt |
12088335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 38085804 - 38085881
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| |||||||||||||||| ||| ||||| | ||| |||||||||||| |
|
|
| T |
38085804 |
tatccagaaatcctagctcaactgacaaaatgtcgaaattgttaggccgaatgacatgatcggggctcgaaccccggt |
38085881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 43426566 - 43426643
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||| |||| ||| |||||||||| |||||||||||||||||||| | |||||||||||||| |||||||||||||| |
|
|
| T |
43426566 |
tatcaagaaatcccagctcaactgaaaaaatgccgaaattgttaggtcagatgccatgaccggagttcgaaccccggt |
43426643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 43967926 - 43967999
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||||| ||| ||| ||||||||||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
43967926 |
cagaaatcctagctcaactggtaaagtgctgaaattgttaggccggatgtcatgatcagggttcgaaccccggt |
43967999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 52256878 - 52256805
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||| |||||||||||||||||| || ||| |||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
52256878 |
agaagttctagctcaactggcaaaaatgtcgatattgttaggctggatgccatgaccggggttcgaaccccggt |
52256805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 19961368 - 19961444
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| |||||||| ||||||| ||||||||||||| |||||| |||||| ||||||| |||||||| |
|
|
| T |
19961368 |
atccagaagtcctaactcaactgacaaaatgtcgaaattgttaggtcggatgtcatgactggggttcgtaccccggt |
19961444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 32946482 - 32946406
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||| |||||||| |||||||| |||||||||| | ||||| |||||| | |||||||||| |||| |
|
|
| T |
32946482 |
tatccagaagtcctaactcaactgtcaaaatgctgaaattgttaagtcggattccatgatcaggttcgaaccacggt |
32946406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 40418604 - 40418528
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||| || ||||||| |||||||||||||| ||| ||||| | |||||||||||||||| |
|
|
| T |
40418604 |
atccagaagtcctagctcaacaggaaaaatgctgaaattgttaggccaaatgtcatgatcggggttcgaaccccggt |
40418528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 308 - 379
Target Start/End: Original strand, 40639602 - 40639674
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaacccc |
379 |
Q |
| |
|
||||||||| ||||||||||||| ||||| ||||||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
40639602 |
tccagaagttctagctcaactggtaaaataccgaaattgttaggccggacgccttgacgggggttcgaacccc |
40639674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 316 - 378
Target Start/End: Complemental strand, 16687668 - 16687606
Alignment:
| Q |
316 |
tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
16687668 |
tcctagctcaaccggcaaaatgccgaaattgttaggccgga-cccatgaccggggttcgaaccc |
16687606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 306 - 365
Target Start/End: Original strand, 17373669 - 17373728
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
|||||| ||||| ||||||| |||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
17373669 |
tatccacaagtcttagctcagctggtaaaatgccgaaattgttaagccggatgccatgac |
17373728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 382
Target Start/End: Complemental strand, 33886478 - 33886423
Alignment:
| Q |
328 |
tggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
33886478 |
tggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt |
33886423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 315 - 369
Target Start/End: Original strand, 2558754 - 2558808
Alignment:
| Q |
315 |
gtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||| ||||| |||| |
|
|
| T |
2558754 |
gtcctagctcaactggcaaaatgctgaaattgttaggtcggatgtcatgatcggg |
2558808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 333 - 382
Target Start/End: Complemental strand, 8128393 - 8128343
Alignment:
| Q |
333 |
aaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
8128393 |
aaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt |
8128343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 9493499 - 9493573
Alignment:
| Q |
310 |
cagaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||| | |||||| |||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
9493499 |
cagaagtcctagctcaacttgataaaatgtcgaaattgttaggctggatgccatgactggggttcgaaccccggt |
9493573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 333 - 382
Target Start/End: Original strand, 35240055 - 35240105
Alignment:
| Q |
333 |
aaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
35240055 |
aaatgccgaaattgttaggccggatgccttgaccggggttcgaaccccggt |
35240105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 334 - 382
Target Start/End: Complemental strand, 2096687 - 2096638
Alignment:
| Q |
334 |
aatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
2096687 |
aatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggt |
2096638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 376
Target Start/End: Complemental strand, 35755800 - 35755735
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaac |
376 |
Q |
| |
|
||||||| |||||| |||| |||||||||||||||||||| || |||||||||| |||| |||||| |
|
|
| T |
35755800 |
agaagtcttagctcgactgacaaaatgccgaaattgttagaccagatgccatgatcggggtcgaac |
35755735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 364
Target Start/End: Complemental strand, 42483052 - 42482999
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||| ||||| |
|
|
| T |
42483052 |
agaagtcctagctcaactgagaaaatgccgaaattgttagaccggatgtcatga |
42482999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 4601429 - 4601496
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
4601429 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
4601496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 5998909 - 5998835
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||| ||| |||| |||||||||||||||| | ||| |||||||| |||||||||||||||| |
|
|
| T |
5998909 |
atccagaagtcctagctcatctgacaaa-tgccgaaattgttagg-ctgataccatgaccggggttcgaaccccggt |
5998835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 316 - 379
Target Start/End: Original strand, 7552603 - 7552667
Alignment:
| Q |
316 |
tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
|||||||| |||| | ||||| ||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
7552603 |
tcctagcttaactagtaaaataccgaaattgttaggccggatgccgtgaccggggttcgaacccc |
7552667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 7824578 - 7824511
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
7824578 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
7824511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 29689606 - 29689539
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
29689606 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
29689539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 30703088 - 30703164
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
|||| |||||||||||||||| |||||||| | |||||||||||||| ||||| ||||||| |||||||||||||| |
|
|
| T |
30703088 |
tatcgagaagtcctagctcaattggcaaaaatatcgaaattgttaggctggatgtcatgaccggggttcgaaccccg |
30703164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 310 - 369
Target Start/End: Complemental strand, 43904622 - 43904562
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||| |||||||||||| |||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
43904622 |
cagaagttctagctcaactgaaaaaaatgtcgaaattgttaggccggatgccatgaccggg |
43904562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 51666049 - 51665982
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
51666049 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacctgggttcgaaccc |
51665982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 54151805 - 54151738
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
54151805 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
54151738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 54158270 - 54158337
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
54158270 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgatccgggttcgaaccc |
54158337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 316 - 382
Target Start/End: Original strand, 32635387 - 32635454
Alignment:
| Q |
316 |
tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||| ||||||||||||| ||||||| ||||| |||||| ||||| | |||||||||||||||| |
|
|
| T |
32635387 |
tcctagcttaactggcaaaatgtcgaaattattaggtcggatgtcatgatcggggttcgaaccccggt |
32635454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 311 - 358
Target Start/End: Complemental strand, 45475357 - 45475310
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg |
358 |
Q |
| |
|
||||| |||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
45475357 |
agaagacctagctcaactggtaaaataccgaaattgttaggccggatg |
45475310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 307 - 366
Target Start/End: Original strand, 46828893 - 46828952
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc |
366 |
Q |
| |
|
||||| ||||| |||||||||| ||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
46828893 |
atccacaagtctcagctcaactgacaaaatgtcgaaattattaggccggatgccatgacc |
46828952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 311 - 377
Target Start/End: Original strand, 52500842 - 52500908
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacc |
377 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||| |||||||| | ||||| ||||||||||||| |
|
|
| T |
52500842 |
agaagtcctagctcaactggc-aaatgtcgaaattgtaaggccggacgtcatgatccgggttcgaacc |
52500908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 33746100 - 33746030
Alignment:
| Q |
313 |
aagtcctagctcaactggca-aaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||| |||| ||| || ||||||||||||||||||| |||||| |||||| |||||| ||||||||| |
|
|
| T |
33746100 |
aagtcctaactcagctgacacaaatgccgaaattgttaggtcggatgtcatgactgggttcaaaccccggt |
33746030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 311 - 380
Target Start/End: Original strand, 36540108 - 36540178
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccg |
380 |
Q |
| |
|
||||||||||| |||| ||| |||||| ||||||||||||||| |||| |||||| | ||||||||||||| |
|
|
| T |
36540108 |
agaagtcctagttcaagtggtaaaatgtcgaaattgttaggccagatgtcatgactgaggttcgaaccccg |
36540178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 323 - 382
Target Start/End: Original strand, 1562809 - 1562870
Alignment:
| Q |
323 |
tcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||| ||||| | |||||||||||||||| |
|
|
| T |
1562809 |
tcaactggcaaaaatgccgaaattgttaggtcggatgtcatgatcggggttcgaaccccggt |
1562870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 47570281 - 47570358
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||| |||||||||||||||| ||||||| | ||||||||| |||||||| ||| | | |||||||||||||||| |
|
|
| T |
47570281 |
tatccaaaagtcctagctcaactcacaaaatgtcaaaattgttaagccggatgtcataatcagggttcgaaccccggt |
47570358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 309 - 369
Target Start/End: Complemental strand, 35208192 - 35208132
Alignment:
| Q |
309 |
ccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||| ||||||| || ||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
35208192 |
ccagaagtctcagctcaagtgataaaatgctgaaattgttaggccggatgtcatgaccggg |
35208132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 36518103 - 36518167
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcga |
374 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||||| |||||||||| ||| |||||||| |
|
|
| T |
36518103 |
agaagtcctagctcaattaacaaaatgccgaaattattaggtcggatgccataaccagggttcga |
36518167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 41377588 - 41377655
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||| |||||||| | ||||| || ||||||||||| |
|
|
| T |
41377588 |
agaagtcctagctcaactggc-aaatgccaaaattgtaaggccggacgtcatgatccaggttcgaaccc |
41377655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 365
Target Start/End: Complemental strand, 46316600 - 46316548
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
46316600 |
aagtcctaactcaactgaaaaaatgccgaaattgttaggtcggatgtcatgac |
46316548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 310 - 380
Target Start/End: Complemental strand, 21569332 - 21569261
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
|||||||| || |||||||| ||||||| | ||||||||||| |||||| ||||||||| ||||||||||| |
|
|
| T |
21569332 |
cagaagtcttaactcaactgacaaaatgacaaaattgttaggacggatgtcatgaccggtattcgaaccccg |
21569261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 315 - 377
Target Start/End: Complemental strand, 25313047 - 25312984
Alignment:
| Q |
315 |
gtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaacc |
377 |
Q |
| |
|
||||||||| |||||| |||||||| ||||||||||| |||||| ||| |||||| |||||||| |
|
|
| T |
25313047 |
gtcctagctgaactggtaaaatgccaaaattgttaggtcggatgtcataaccgggattcgaacc |
25312984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 379
Target Start/End: Original strand, 32956775 - 32956842
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
|||||||| |||||| || ||||||| |||||||||||||| || | ||||||| ||||||||||||| |
|
|
| T |
32956775 |
aagtcctaactcaaccggtaaaatgctgaaattgttaggccagacgtcatgaccggggttcgaacccc |
32956842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 305 - 364
Target Start/End: Original strand, 39172037 - 39172096
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
||||| |||||||||||| ||||||||||||| | |||||||||||||| ||| ||||| |
|
|
| T |
39172037 |
atatcaagaagtcctagcataactggcaaaatgtcaaaattgttaggccgaatgtcatga |
39172096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 382
Target Start/End: Complemental strand, 48209535 - 48209484
Alignment:
| Q |
332 |
aaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| |||| |||||||||||||| |
|
|
| T |
48209535 |
aaaataccgaaattgttaggccgaatgccatggccggagttcgaaccccggt |
48209484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 313 - 367
Target Start/End: Original strand, 9318523 - 9318577
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg |
367 |
Q |
| |
|
||||| ||| ||||||||||||||| |||||||||||||| ||||| ||| |||| |
|
|
| T |
9318523 |
aagtcttagttcaactggcaaaatgtcgaaattgttaggctggatgtcataaccg |
9318577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 306 - 379
Target Start/End: Complemental strand, 18462086 - 18462012
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
||||||||||| || |||||||||| |||||| ||||||| |||| ||||||| || || | ||||||||||||| |
|
|
| T |
18462086 |
tatccagaagttctggctcaactggtaaaatgtcgaaattattagaccggatgtcaagatcggggttcgaacccc |
18462012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 377
Target Start/End: Complemental strand, 27719244 - 27719174
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaacc |
377 |
Q |
| |
|
|||||||||| ||||||||| || |||||| ||||||||||| | ||||| ||||||||| ||||||||| |
|
|
| T |
27719244 |
tccagaagtcatagctcaacgggtaaaatgtcgaaattgttaagtcggatatcatgaccggagttcgaacc |
27719174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 29216811 - 29216881
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
||||| || ||||| ||| |||||| ||||||||||||||||||| | |||||||| |||| ||||||||| |
|
|
| T |
29216811 |
aagtcttaactcaattggaaaaatgtcgaaattgttaggccggatactatgaccggagttcaaaccccggt |
29216881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 311 - 365
Target Start/End: Complemental strand, 46800157 - 46800103
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
||||| |||| ||||| ||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
46800157 |
agaagacctaactcaattggcaaaatgccgaaattgttagatcggatgtcatgac |
46800103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 337 - 377
Target Start/End: Complemental strand, 2947819 - 2947778
Alignment:
| Q |
337 |
gccgaaattgttaggccggatgccatgacc-gggttcgaacc |
377 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
2947819 |
gccgaaattgttaggccggatgtcatgaccggggttcgaacc |
2947778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 308 - 379
Target Start/End: Complemental strand, 10071645 - 10071572
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccat-gaccgggttcgaacccc |
379 |
Q |
| |
|
|||| ||||||||||||||||| ||||| || | |||||||||||| ||||||||| | | ||||||||||||| |
|
|
| T |
10071645 |
tccacaagtcctagctcaactgacaaaaatgtcaaaattgttaggctggatgccatggtcggggttcgaacccc |
10071572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 364
Target Start/End: Complemental strand, 21893375 - 21893322
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
||||||||||||| |||||||||| || ||||||||||||| | |||| ||||| |
|
|
| T |
21893375 |
agaagtcctagcttaactggcaaagtgtcgaaattgttaggtcagatgtcatga |
21893322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 336 - 369
Target Start/End: Complemental strand, 34481892 - 34481859
Alignment:
| Q |
336 |
tgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
34481892 |
tgccgaaattgttaggccggatgacatgaccggg |
34481859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 323 - 364
Target Start/End: Original strand, 43357235 - 43357276
Alignment:
| Q |
323 |
tcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| |||| |
|
|
| T |
43357235 |
tcaactggcaaaattccgaaattgttaagccggatgctatga |
43357276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 316 - 380
Target Start/End: Original strand, 44791717 - 44791781
Alignment:
| Q |
316 |
tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||| | ||||| | |||||||||||||| |
|
|
| T |
44791717 |
tcctagctcaactggcaaaatgctaaaattgttagaccggacg-catgatcggggttcgaaccccg |
44791781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 339 - 382
Target Start/End: Complemental strand, 5350015 - 5349971
Alignment:
| Q |
339 |
cgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||| |||||| | |||||||||||||||| |
|
|
| T |
5350015 |
cgaaattgttaggccggataccatgatcggggttcgaaccccggt |
5349971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 323 - 382
Target Start/End: Complemental strand, 6419778 - 6419718
Alignment:
| Q |
323 |
tcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||| ||| |||||| |||||||||||||||||||| ||||||| | ||||||||| |||| |
|
|
| T |
6419778 |
tcaattggtaaaatgtcgaaattgttaggccggatgtcatgaccagcgttcgaaccgcggt |
6419718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 319 - 378
Target Start/End: Complemental strand, 36229110 - 36229051
Alignment:
| Q |
319 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
36229110 |
tagctcaactggcaaa-tgccgaaattgcaaggccggacgtcatgatccgggttcgaaccc |
36229051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 42392929 - 42392862
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| |||| | ||||| ||||| |||||||| |
|
|
| T |
42392929 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggtcggacgtcatgatccgggctcgaaccc |
42392862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 307 - 351
Target Start/End: Original strand, 49285507 - 49285551
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttagg |
351 |
Q |
| |
|
|||||||||||||| ||| |||| ||||||| ||||||||||||| |
|
|
| T |
49285507 |
atccagaagtcctaactccactgacaaaatgtcgaaattgttagg |
49285551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 305 - 365
Target Start/End: Original strand, 54950032 - 54950092
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
||||||||||||| || |||||||| |||||| | ||||||||||| ||| ||||||||| |
|
|
| T |
54950032 |
atatccagaagtcttaactcaactgacaaaattctaaaattgttaggtcgggtgccatgac |
54950092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 71; Significance: 5e-32; HSPs: 118)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 10635486 - 10635564
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10635486 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
10635564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 19338309 - 19338231
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19338309 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
19338231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 48391953 - 48392031
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48391953 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccagggttcgaaccccggt |
48392031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 29005088 - 29005165
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29005088 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
29005165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 43676153 - 43676077
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43676153 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
43676077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 40958705 - 40958627
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
40958705 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggt |
40958627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 48314166 - 48314242
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
48314166 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
48314242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 42631115 - 42631040
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
42631115 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccg |
42631040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 306 - 368
Target Start/End: Original strand, 28999372 - 28999434
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28999372 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg |
28999434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 270451 - 270374
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
270451 |
atccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
270374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 17068150 - 17068227
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
17068150 |
tatccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgagcggggttcgaaccccggt |
17068227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 307 - 379
Target Start/End: Original strand, 49948240 - 49948313
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaacccc |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49948240 |
atccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccgggattcgaacccc |
49948313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 43086600 - 43086524
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
43086600 |
atccataagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt |
43086524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 304 - 382
Target Start/End: Complemental strand, 15906299 - 15906220
Alignment:
| Q |
304 |
catatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| | |||||||||||||||| |
|
|
| T |
15906299 |
catatccagaagtcctagctcaactagcaaaatgccgaaattgttaggccagatgccatgatcagggttcgaaccccggt |
15906220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 316 - 382
Target Start/End: Complemental strand, 20164193 - 20164126
Alignment:
| Q |
316 |
tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20164193 |
tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
20164126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 40809342 - 40809280
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40809342 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggg |
40809280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 3315796 - 3315869
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
3315796 |
cagaagtcctagctcaactggcaaaatgccgacattgttaggccggatgccatgaccaggattcgaaccccggt |
3315869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 4126573 - 4126650
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
4126573 |
tatccagaagtcctagctcaactgacaaaatgcggaaattgttaggccggatgccatgatcagggttcgaaccccggt |
4126650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 310 - 378
Target Start/End: Original strand, 24119658 - 24119727
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
24119658 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
24119727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 5598300 - 5598376
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
5598300 |
atccagaagtcctagctcaactggaaaaatgccgaaattgttaggtcggatgtcatgaccggagttcgaaccccggt |
5598376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 13555849 - 13555777
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
13555849 |
agaagtcctagctcaactggcaaaatgccgaaattattaggccggatgtcatgaccggggttcgaaccccggt |
13555777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 305 - 380
Target Start/End: Complemental strand, 32880710 - 32880634
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccg |
380 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32880710 |
atatctagaagtcctaactcaactggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccccg |
32880634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 48731881 - 48731809
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
48731881 |
agaagtcctagctcaactgacaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccccggt |
48731809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 49500860 - 49500936
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||||| |
|
|
| T |
49500860 |
atccacaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcgaggttcgaaccccggt |
49500936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 13018070 - 13018148
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||| |||||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
13018070 |
atatcaagaagtcttagctcaactggcaaagtgccgaaattgttagaccggatgccatgaccggggttcgaaccccggt |
13018148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 15331185 - 15331115
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
15331185 |
aagtcctagctcaactggaaaaatgccgaaattgttaggtcggatgccatgaccgaggttcgaaccccggt |
15331115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 11403171 - 11403244
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
11403171 |
cagaagtcctagctcaactgggaaaatgccgaaattgttaggtcggatgccatgatcggggttcgaaccccggt |
11403244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 18475107 - 18475180
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| | |||||||||||| |
|
|
| T |
18475107 |
tatccagaagtcctagctcaactggcaaaataccgacattgttaggccggatgccatgatcggggttcgaaccc |
18475180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 21522315 - 21522392
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||| |||||||||||||||| ||||||| |||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
21522315 |
tatctagaagtcctagctcaattggcaaagtgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggt |
21522392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 34010092 - 34010169
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| | ||||| |||||||||| |
|
|
| T |
34010092 |
tatccagaagtcttagctcaactggcaaaatgtcgaaattgttaggccggatgccatgatcggggtttgaaccccggt |
34010169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 41445156 - 41445083
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
41445156 |
cagaagtcctagctcaactggcaaaatgccgacattgttaggccggatgtcatgatcggagttcgaaccccggt |
41445083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 18089897 - 18089821
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| ||| ||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
18089897 |
atccagaagtcttagttcaactgacaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
18089821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 25821079 - 25821007
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25821079 |
atccagaagtcctagctcaactgataaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccc |
25821007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 380
Target Start/End: Original strand, 39606407 - 39606478
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39606407 |
agaagtcctagctcaactggcaaaaatgccgatattgttaggccggatgccatgaccggggttcgaaccccg |
39606478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 40685527 - 40685590
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
40685527 |
tatccagaagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgtcatgaccggg |
40685590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 50248027 - 50248102
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
50248027 |
tatccagaagtcctagctcaactgataaaatgtcgaaattgttaggccggatgtcatgaccgaggttcgaaccccg |
50248102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 311 - 369
Target Start/End: Original strand, 5790061 - 5790119
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5790061 |
agaagtcctagcttaactggcaaaatgccgaaattgttaggccggatgtcatgaccggg |
5790119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 35010718 - 35010644
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| || |||||||||||| |
|
|
| T |
35010718 |
atccagaagtcctagctcaactagcaaaatgccgaaattgttaggctggatgccatgattggagttcgaaccccg |
35010644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 318 - 382
Target Start/End: Complemental strand, 33845722 - 33845657
Alignment:
| Q |
318 |
ctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
33845722 |
ctagctcaactggcaaaatgccgaaattgttagaccggatgtcatgaccggagttcgaaccccggt |
33845657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 318 - 382
Target Start/End: Original strand, 33948256 - 33948321
Alignment:
| Q |
318 |
ctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
33948256 |
ctagctcaactggcaaaatgccgaaattgttagaccggatgtcatgaccggagttcgaaccccggt |
33948321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 305 - 380
Target Start/End: Original strand, 15104041 - 15104117
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||| |||||||||||||||||| ||||| | |||||||||||||| |
|
|
| T |
15104041 |
atatctagaagtcctagctcaactgacaaaatgccaaaattgttaggccggatgtcatgatcggggttcgaaccccg |
15104117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 26261422 - 26261346
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||||| |||||| | ||||||||| |||||| |
|
|
| T |
26261422 |
atccacaagtcctagctcaactggaaaaatgccgaaattgttaggccggataccatgatcggggttcgaatcccggt |
26261346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 305 - 376
Target Start/End: Original strand, 43025883 - 43025955
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaac |
376 |
Q |
| |
|
||||||||||||||||| ||||||| |||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43025883 |
atatccagaagtcctagttcaactgacaaaatatcgaaattgttaggccggatgccatgacctgggttcgaac |
43025955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 305 - 364
Target Start/End: Complemental strand, 19279983 - 19279924
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||| |
|
|
| T |
19279983 |
atatccagaagtcctagctcaactggtaaaatgccgaaattgttaggtcggataccatga |
19279924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 25083249 - 25083175
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| | |||||||||||||||| |
|
|
| T |
25083249 |
tatccagaagtcctagctcaactggcaaaatgctgaaattgt---gccggatgccatgatcggggttcgaaccccggt |
25083175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 305 - 364
Target Start/End: Original strand, 30455201 - 30455260
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
30455201 |
atatccagaagtcctagctcaactgataaaatgtcgaaattgttaggccggatgccatga |
30455260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 39522884 - 39522811
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||||||||| | | |||||||||| ||||| |
|
|
| T |
39522884 |
cagaagtcctaactcaactggcaaaatgcagaaattgttaggccggatgccattatcggggttcgaactccggt |
39522811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 39787780 - 39787703
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||| |||||||||||||||||| |||||| |||||||||||| ||| ||||||||||| |||||||||| ||||| |
|
|
| T |
39787780 |
tatccacaagtcctagctcaactggtaaaatgtcgaaattgttagaccgaatgccatgaccggggttcgaactccggt |
39787703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 311 - 375
Target Start/End: Complemental strand, 3840487 - 3840423
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaa |
375 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
3840487 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggctggatgtcatgatggggttcgaa |
3840423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 27078548 - 27078623
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||| | |||||||||||| ||||||| |||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
27078548 |
atccagaaattctagctcaactg-caaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
27078623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 309 - 380
Target Start/End: Original strand, 29511109 - 29511181
Alignment:
| Q |
309 |
ccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||||| ||| |||||| |||||||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
29511109 |
ccagaagtcctagctcaattggtaaaatgacgaaattgttaggccgaatgtcatgaccggggttcgaaccccg |
29511181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 36586250 - 36586326
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||| ||||||||| |||||| |||||||||||||||||||||| ||| | |||||||||||||||| |
|
|
| T |
36586250 |
atccacaagtcctaactcaactggtaaaatgtcgaaattgttaggccggatgccgtgatcggggttcgaaccccggt |
36586326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 310 - 369
Target Start/End: Original strand, 18216346 - 18216405
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18216346 |
cagaagtcctagctcaatgggtaaaatgccgaaattgttaggccggatgccatgatcggg |
18216405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 310 - 380
Target Start/End: Complemental strand, 40962828 - 40962757
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||| |||||| ||||||||||| | |||||||||||||| |
|
|
| T |
40962828 |
cagaagtcctagctcaactgacaaaatgccaaaattattaggctggatgccatgatcggggttcgaaccccg |
40962757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 380
Target Start/End: Original strand, 5322591 - 5322665
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||||||||||||| |||| ||||||| |||||||||||||| |
|
|
| T |
5322591 |
atccagaagttctagctcaactgacaaaatgctgaaattgttaggctggatatcatgaccggggttcgaaccccg |
5322665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 310 - 379
Target Start/End: Complemental strand, 8194088 - 8194018
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
8194088 |
cagaagtcctagcttaactgataaaataccgaaattgttaggcctgatgccatgaccggggttcgaacccc |
8194018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 8214622 - 8214684
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
8214622 |
atccagaagtcctagctcaactggaaaaatatcgaaattgttaggccggaccccatgaccggg |
8214684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 305 - 366
Target Start/End: Complemental strand, 14971684 - 14971622
Alignment:
| Q |
305 |
atatccagaagtcctag-ctcaactggcaaaatgccgaaattgttaggccggatgccatgacc |
366 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||| |||||||||||| ||||||| |
|
|
| T |
14971684 |
atatccagaagtcctaggctcaactggcaaaatgccaaaattattaggccggatgtcatgacc |
14971622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 382 - 422
Target Start/End: Original strand, 6837956 - 6837996
Alignment:
| Q |
382 |
tgccatctccttggatttcaattgcagcaaaccttgatgat |
422 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6837956 |
tgccatctccttggatttcaattgcagcaaaccttgatgat |
6837996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 313 - 369
Target Start/End: Complemental strand, 11797522 - 11797466
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||| ||| |||||||||| |
|
|
| T |
11797522 |
aagtcctaactcaactggcaaaatgtcgaaattgttaggccgaatgtcatgaccggg |
11797466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 15952957 - 15952885
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||| |||| | |||||||||| ||||| |
|
|
| T |
15952957 |
agaagtcgtagctcaactggcaaaatgccgaaattgttaggtcggatgttatgatcggggttcgaactccggt |
15952885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 309 - 369
Target Start/End: Complemental strand, 22561294 - 22561234
Alignment:
| Q |
309 |
ccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||| | |||||||||||| ||||||||||||||||||||||| ||| |||| |
|
|
| T |
22561294 |
ccagaagtcctagtttaactggcaaaataccgaaattgttaggccggatgccgtgatcggg |
22561234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 306 - 377
Target Start/End: Complemental strand, 29510781 - 29510709
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacc |
377 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||||||| |||||| ||||||| ||||||||||| |
|
|
| T |
29510781 |
tatccagaagtcctaactcaactgtcaaaatgccaaaattgttagatcggatgtcatgaccggggttcgaacc |
29510709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 306 - 362
Target Start/End: Original strand, 32533825 - 32533881
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccat |
362 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
32533825 |
tatccagaagttctagttcaactggcaaaatgccaaaattgttaggccgaatgccat |
32533881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 39467027 - 39467099
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||||| |||| | |||||||||||||||| |
|
|
| T |
39467027 |
agaagtcctagctcaactggcaaaatggtaaaattgttaggccagatgctatgatcggggttcgaaccccggt |
39467099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 46850963 - 46851039
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||| ||| |||||| |||||||| ||||||||||||| |||||||||||| |||||||||||| ||||| |
|
|
| T |
46850963 |
atccacaagtcatagttcaactagcaaaatgtcgaaattgttaggtcggatgccatgatccgggttcgaactccggt |
46851039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 382
Target Start/End: Original strand, 9705547 - 9705602
Alignment:
| Q |
328 |
tggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9705547 |
tggcaaaatgccaaaattgttaggccggatgccatgactggggttcgaaccccggt |
9705602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 313 - 378
Target Start/End: Complemental strand, 10430463 - 10430396
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgac-cgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
10430463 |
aagtcctagctcaactgacaaaaatgccgaaattgttaggccggatgcaatgactggggttcgaaccc |
10430396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 305 - 379
Target Start/End: Complemental strand, 45007822 - 45007747
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaacccc |
379 |
Q |
| |
|
||||||| || ||||||||||| ||| ||||| |||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
45007822 |
atatccaaaaatcctagctcaattggtaaaatatcgaaattgttaggccggatgtcatgaccgaggttcgaacccc |
45007747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 307 - 380
Target Start/End: Original strand, 49632553 - 49632628
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccg |
380 |
Q |
| |
|
||||| ||||||||| |||||||| |||| ||||||||||||||||| ||||| |||||||| ||||||||||||| |
|
|
| T |
49632553 |
atccataagtcctagttcaactggtaaaaatgccgaaattgttaggctggatgtcatgaccgaggttcgaaccccg |
49632628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 46561364 - 46561302
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
46561364 |
atccagaagttctagttcaactagcaaaatgccaaaattgttagtccggatgccatgatcggg |
46561302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 313 - 380
Target Start/End: Complemental strand, 7204632 - 7204563
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| | ||||||| |||||||||||||| |
|
|
| T |
7204632 |
aagtcctagctcaactggcaaaaatgccgaaattgttaggccgaacatcatgaccggggttcgaaccccg |
7204563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 356
Target Start/End: Original strand, 14890286 - 14890335
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||| ||||| |
|
|
| T |
14890286 |
atccagaagtcctagctcaactggcaaaatgccaaaaatgttagaccgga |
14890335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 21897807 - 21897734
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||||| ||||||| |||||||||||||| |||||| |||| | |||||||||| ||||| |
|
|
| T |
21897807 |
cagaaatcctagctcaactgacaaaatgtcgaaattgttaggctggatgctatgatcggggttcgaactccggt |
21897734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 23225420 - 23225343
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||||||||| |||| || | ||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
23225420 |
atccacaagtcctagctcaactggtaaaaatgtcaaaattgttaggtcggatgccatgacaggggttcgaaccccggt |
23225343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 364
Target Start/End: Original strand, 40503596 - 40503653
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||||||||| |||||||||||| ||||||| ||||||||||||||||||| ||||| |
|
|
| T |
40503596 |
atccagaagttctagctcaactgacaaaatgttgaaattgttaggccggatgtcatga |
40503653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 330 - 382
Target Start/End: Complemental strand, 47429698 - 47429645
Alignment:
| Q |
330 |
gcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||| |||||| |
|
|
| T |
47429698 |
gcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaatcccggt |
47429645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 13048932 - 13048860
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||| |||||| |||||||| ||||| |||||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
13048932 |
agaaatcctagttcaactggtaaaatatcgaaattgttaggccggatgtcatgatcggagttcgaaccccggt |
13048860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 13053929 - 13053857
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||| |||||| |||||||| ||||| |||||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
13053929 |
agaaatcctagttcaactggtaaaatatcgaaattgttaggccggatgtcatgatcggagttcgaaccccggt |
13053857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 32007078 - 32007145
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
32007078 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
32007145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 41808206 - 41808273
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
41808206 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
41808273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 12282613 - 12282676
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||| ||||||||||| ||||||| ||| || |||||||||||||| |||||||||||||||| |
|
|
| T |
12282613 |
tatctagaagtcctagttcaactgataaagtgtcgaaattgttaggctggatgccatgaccggg |
12282676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 23913617 - 23913680
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||| ||||||||| |||| ||| ||| |||||||||||| ||||| |||||||||| |
|
|
| T |
23913617 |
tatccagaagttctagctcaagtggctaaaagccaaaattgttaggctggatgtcatgaccggg |
23913680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 314 - 382
Target Start/End: Original strand, 236575 - 236645
Alignment:
| Q |
314 |
agtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||| |||||||| ||||| || |||||||||||||||||| | ||||||| |||||||||||||||| |
|
|
| T |
236575 |
agtcctacctcaactgacaaaaatgtcgaaattgttaggccggacgtcatgaccggggttcgaaccccggt |
236645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 40241493 - 40241563
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
40241493 |
aagtcctaactcaactgataaaatgtcgaaattgttaggccggatatcatgaccggagttcgaacctcggt |
40241563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 351
Target Start/End: Original strand, 41651078 - 41651116
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttagg |
351 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41651078 |
aagtcctagctcaactggtaaaatgccgaaattgttagg |
41651116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 313 - 380
Target Start/End: Complemental strand, 17540200 - 17540131
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||||||||| || | ||||||| |||||||||||||| |
|
|
| T |
17540200 |
aagtcctagctcaactagtaaaaatgccgaaattgttaggccagacgtcatgaccggggttcgaaccccg |
17540131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 311 - 364
Target Start/End: Original strand, 21938946 - 21938998
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||| |||||||||| ||||| |
|
|
| T |
21938946 |
agaagtcctagctcaactggtaaa-tgccgaaattgtaaggccggatgtcatga |
21938998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 27855995 - 27856072
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||| || || |||||||||||| ||||||||||||||||||||| |||| ||||| | ||||||||| |||||| |
|
|
| T |
27855995 |
tatccacaaatcttagctcaactggagaaatgccgaaattgttaggccagatgtcatgatcggggttcgaatcccggt |
27856072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 334 - 382
Target Start/End: Complemental strand, 29803275 - 29803226
Alignment:
| Q |
334 |
aatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | |||||||||||||||| |
|
|
| T |
29803275 |
aatgccgaaattgttaggccagatgccatgatcggggttcgaaccccggt |
29803226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 5055912 - 5055845
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
5055912 |
agaagtcctagctcagctggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
5055845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 6669305 - 6669381
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| |||||||| || ||||||| ||||| |||| |||||| |||||||| |||||||||||||| |
|
|
| T |
6669305 |
tatccagaagtcttagctcaattgataaaatgctaaaattattagaccggatatcatgaccgagttcgaaccccggt |
6669381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 363
Target Start/End: Original strand, 11786102 - 11786158
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatg |
363 |
Q |
| |
|
||||| |||| |||||||||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
11786102 |
atccacaagttctagctcaactgataaaatgctgaaattgttaggccggatgtcatg |
11786158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 356
Target Start/End: Original strand, 28381225 - 28381273
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| ||||||||||||| |||| |
|
|
| T |
28381225 |
tccataagtcctagctcaactggctaaatgtcgaaattgttaggacgga |
28381273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 29587256 - 29587323
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | | ||||| |||||||||||| |
|
|
| T |
29587256 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcgtgacctgggttcgaaccc |
29587323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 29994507 - 29994440
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||| || | ||||| |||||||||||||| |
|
|
| T |
29994507 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccagacgtcatgatccgggttcgaaccc |
29994440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 31278571 - 31278499
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccc |
378 |
Q |
| |
|
||||||||||||| |||||||| |||||||| ||||| |||||| ||||| |||||||| ||||||||||| |
|
|
| T |
31278571 |
atccagaagtcctggctcaactaccaaaatgctgaaatagttaggttggatgtcatgaccgaggttcgaaccc |
31278499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 353
Target Start/End: Complemental strand, 38886512 - 38886472
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggcc |
353 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
38886512 |
aagtcctagctcaactggtaaaataccgaaattgttaggcc |
38886472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 369
Target Start/End: Complemental strand, 43500266 - 43500210
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||| |||||||||||| |||||| ||||||||||||| ||||||| |||| |||| |
|
|
| T |
43500266 |
aagtcttagctcaactggtaaaatgtcgaaattgttaggtcggatgctatgatcggg |
43500210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 48660026 - 48660093
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | |||| |||||||||||||| |
|
|
| T |
48660026 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgttatgacccgggttcgaaccc |
48660093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 308 - 378
Target Start/End: Original strand, 2112747 - 2112818
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||| |||||| |||| | ||||||| |||||||||||| |
|
|
| T |
2112747 |
tccacaagtcctagctcaactagcaaaatgatgaaatcgttaggtcggacgtcatgaccggggttcgaaccc |
2112818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 306 - 357
Target Start/End: Complemental strand, 15324583 - 15324532
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggat |
357 |
Q |
| |
|
|||||| ||||| ||||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
15324583 |
tatccacaagtcatagctcaactgacaaaatgccgaaattattaggtcggat |
15324532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 336 - 382
Target Start/End: Original strand, 35758303 - 35758350
Alignment:
| Q |
336 |
tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
35758303 |
tgccgaaattgttaggctcgatgccatgaccggggttcgaaccccggt |
35758350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 316 - 378
Target Start/End: Original strand, 43837095 - 43837158
Alignment:
| Q |
316 |
tcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccgggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||||||||| || || ||||||||||||||||| |||||| ||||| ||||| |
|
|
| T |
43837095 |
tcctagctcaactggcaaaaatgtcggaattgttaggccggatgttatgaccaggttcaaaccc |
43837158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 311 - 380
Target Start/End: Complemental strand, 50145258 - 50145187
Alignment:
| Q |
311 |
agaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||| ||| |||||| | | |||||||||||||||| |||||| ||| ||||||||||| |
|
|
| T |
50145258 |
agaagtcctagctcaaccggcaaaaatgtcaatattgttaggccggatgtcatgactgggattcgaaccccg |
50145187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 311 - 369
Target Start/End: Original strand, 1576377 - 1576435
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||| || ||||||||| |||||||| |||||||| | ||||||||||||||||| |
|
|
| T |
1576377 |
agaagtcttaactcaactggaaaaatgccaaaattgtttgatcggatgccatgaccggg |
1576435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 335 - 369
Target Start/End: Complemental strand, 16084334 - 16084300
Alignment:
| Q |
335 |
atgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
16084334 |
atgccgaaattgttaggccggatgccatgatcggg |
16084300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 313 - 378
Target Start/End: Original strand, 25376196 - 25376262
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||| |||||| |||||| ||||||||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
25376196 |
aagtcctagttcaactatcaaaataccgaaattgttagaccggatttcatgaccggggttcgaaccc |
25376262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 48302283 - 48302345
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||| ||||||||| ||||||| ||||||||||||||||| |||| || ||||||||||| |
|
|
| T |
48302283 |
atccacaagtcctagttcaactgaggaaatgccgaaattgttaagccgaataccatgaccggg |
48302345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 52492812 - 52492734
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||||| ||||||||| || |||||| ||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
52492812 |
atatcctgaagttctagctcaattgataaaatgttgaaattgttaggccggatgtcatgattggggttcgaaccccggt |
52492734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 382 - 423
Target Start/End: Original strand, 8976516 - 8976557
Alignment:
| Q |
382 |
tgccatctccttggatttcaattgcagcaaaccttgatgatg |
423 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
8976516 |
tgccatctccttggatttcaattggagcaggccttgatgatg |
8976557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 308 - 376
Target Start/End: Complemental strand, 23810012 - 23809943
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaac |
376 |
Q |
| |
|
||||||||||||| ||||| | |||||| |||||||||||||||||||| ||||| ||| |||||||| |
|
|
| T |
23810012 |
tccagaagtcctaattcaacagacaaaatatcgaaattgttaggccggatgtcatgatcggagttcgaac |
23809943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 28455878 - 28455922
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
28455878 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga |
28455922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 36018881 - 36018939
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||| ||||| |||||| |||||||||||||||||||| ||||| |||| |
|
|
| T |
36018881 |
atccagaagtcctagttcaac----aaaatgtcgaaattgttaggccggatgtcatgatcggg |
36018939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 313 - 376
Target Start/End: Complemental strand, 37186941 - 37186876
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaac |
376 |
Q |
| |
|
|||| ||||||||||||| |||| |||||||||||||| |||||| | ||||||| |||||||||| |
|
|
| T |
37186941 |
aagttctagctcaactggtaaaaatgccgaaattgttaagccggacgtcatgaccagggttcgaac |
37186876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 316 - 357
Target Start/End: Original strand, 37771077 - 37771118
Alignment:
| Q |
316 |
tcctagctcaactggcaaaatgccgaaattgttaggccggat |
357 |
Q |
| |
|
||||||||||| ||| |||||| ||||||||||||||||||| |
|
|
| T |
37771077 |
tcctagctcaattggtaaaatgtcgaaattgttaggccggat |
37771118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 313 - 364
Target Start/End: Complemental strand, 16867516 - 16867464
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||| |||||||| |||| ||||| |
|
|
| T |
16867516 |
aagtcctaactcaactggcaaaaatgccgaaatcgttaggccagatgtcatga |
16867464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 313 - 357
Target Start/End: Original strand, 28689591 - 28689634
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggat |
357 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
28689591 |
aagtccaagctcaactggcaaa-tgccgaaattgttaggctggat |
28689634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 70; Significance: 2e-31; HSPs: 84)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 8448272 - 8448195
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8448272 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
8448195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 8457076 - 8456999
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8457076 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
8456999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 305 - 385
Target Start/End: Complemental strand, 17534654 - 17534573
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
17534654 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtgcc |
17534573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 385
Target Start/End: Complemental strand, 16496783 - 16496702
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16496783 |
tatccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcc |
16496702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 2314728 - 2314652
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
2314728 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
2314652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 305 - 379
Target Start/End: Complemental strand, 31205314 - 31205239
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
31205314 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaacccc |
31205239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 735443 - 735520
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
735443 |
tatccagaagttctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt |
735520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 8939624 - 8939701
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
8939624 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt |
8939701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 310 - 378
Target Start/End: Complemental strand, 18861893 - 18861824
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18861893 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
18861824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 305 - 380
Target Start/End: Original strand, 1241592 - 1241668
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
1241592 |
atattcagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccg |
1241668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 4083586 - 4083662
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||| |
|
|
| T |
4083586 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaacaccggt |
4083662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 8329687 - 8329611
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8329687 |
atccaaaagtcctagctcaactggcaatatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
8329611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 10263200 - 10263128
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10263200 |
atccagaagtcctagctcaactggcaaagtgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
10263128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 305 - 380
Target Start/End: Complemental strand, 13507441 - 13507365
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
13507441 |
atatccagaagtcctagctcaactgggaaaatgccgaaattgttaggctggatgccatgaccggtgttcgaaccccg |
13507365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 32643858 - 32643781
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
32643858 |
tatccagaagtcctaactcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggt |
32643781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 305 - 380
Target Start/End: Original strand, 4480471 - 4480547
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4480471 |
atatccagaagtcctaactcaactggcaaaatgccgaaattgttaggccggatgccatgattggggttcgaaccccg |
4480547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 34287300 - 34287224
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34287300 |
atccagaagtcatagttcaactggcaaaatgccgacattgttaggccggatgccatgaccggggttcgaaccccggt |
34287224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 306 - 369
Target Start/End: Complemental strand, 13540291 - 13540228
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13540291 |
tatccagaagtcctagctcaaatggcaaaatgccgaaattgttaggccggatgcaatgaccggg |
13540228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 310 - 379
Target Start/End: Original strand, 16244413 - 16244483
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
16244413 |
cagaagtcctagatcaactggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaacccc |
16244483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 32107961 - 32107888
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| | |||||||||||||||| |
|
|
| T |
32107961 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggctggatgtcatgatcggggttcgaaccccggt |
32107888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 1686363 - 1686287
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
1686363 |
atccagaagtcgtagctcaactgctaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt |
1686287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 5603576 - 5603504
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
5603576 |
atccagaagttctagctcaactggaaaaatgccgaaattattaggccggatgccatgaccggggttcgaaccc |
5603504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 307 - 377
Target Start/End: Original strand, 7098805 - 7098876
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaacc |
377 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7098805 |
atccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgactagggttcgaacc |
7098876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 4996871 - 4996933
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
4996871 |
atccagaagtcctagctcaactgacaaaatgctgaaattgttaggccggatgccatgatcggg |
4996933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 380
Target Start/End: Original strand, 29183657 - 29183731
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| |||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29183657 |
atccagaagtcctagctcaattggtaaaataccgacattgttaggccggatgccatgaccggggttcgaaccccg |
29183731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 31747117 - 31747039
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||| ||||| || |||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
31747117 |
atattcagaaatcttagctcaactggtaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt |
31747039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 6266630 - 6266707
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||| ||||||||||||||||||| |||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
6266630 |
tatccggaagtcttagctcaactggcaaaatgtcgaaattgttagaccggatgtcatgaccggagttcgaaccccggt |
6266707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 12795145 - 12795072
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||| ||||||||||| |||| |
|
|
| T |
12795145 |
cagaagtcctagctcaactagtaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccgcggt |
12795072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 15953232 - 15953309
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| ||| ||| |||||| |||||||||||||||| |
|
|
| T |
15953232 |
tatccagaagtcctagctcaactggtaaaatgccgaaattgttagaccgaatgtaatgaccggggttcgaaccccggt |
15953309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 307 - 379
Target Start/End: Original strand, 27866587 - 27866660
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| |||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
27866587 |
atccagaagtcccagctcaattggcaaaatgccaaaattgttaggccggatgccatgatcggggttcgaacccc |
27866660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 28594201 - 28594124
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| | ||||||||||| |||| |
|
|
| T |
28594201 |
tatccagaagtcctaactcaactggcaaaaggtcgaaattgttaggccggatgccatgatcggggttcgaacctcggt |
28594124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 31444420 - 31444343
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
31444420 |
atccagaagtcctagctcaaccggcaaaaatgccgaaattgttaggccgggtgccatgactggggttcgaaccccggt |
31444343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 10181044 - 10181116
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||| | |||||||||||| |
|
|
| T |
10181044 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcgtgatcggggttcgaaccc |
10181116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 4891007 - 4891069
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
4891007 |
atccagaagtcttagctcaactggaaaaatgccgaaattgttaggccagatgtcatgaccggg |
4891069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 10330802 - 10330880
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| ||||||||||||| |||||||||||| ||| |||||||||||| |
|
|
| T |
10330802 |
tatccacaagtcctagctcaactggcaaaaatgccaaaattgttaggccagatgccatgaccggggatcgaaccccggt |
10330880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 306 - 379
Target Start/End: Complemental strand, 11242727 - 11242653
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaacccc |
379 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
11242727 |
tatccagaagtcctagctcaactaataaaatgccgaaattgttaggacggatgccatgactggggttcgaacccc |
11242653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 310 - 364
Target Start/End: Original strand, 21513074 - 21513128
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
21513074 |
cagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgtcatga |
21513128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 34830783 - 34830853
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
34830783 |
aagtcctagctcaactgataaaatgccgaaattgttaggtcggatgccatgaccggagttcgaagcccggt |
34830853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 31057830 - 31057907
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| || ||||||| |||||||| ||||||| |||||||||||||||| |
|
|
| T |
31057830 |
tatccagaagtcatagctcaactggcgaaatgctgacattgttaagccggatgtcatgaccggggttcgaaccccggt |
31057907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 2301504 - 2301432
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||| |||||| ||| ||| |||||||||||||||| |
|
|
| T |
2301504 |
agaaatcctagctcaactggcaaaatgccaaaattgttaggtcggatgtcataaccggggttcgaaccccggt |
2301432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 323 - 382
Target Start/End: Original strand, 2959008 - 2959068
Alignment:
| Q |
323 |
tcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2959008 |
tcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
2959068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 8374141 - 8374213
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
|||||||||| ||| ||||||||| ||||||||||||||||||||| ||||||||||| | |||||||||||| |
|
|
| T |
8374141 |
atccagaagttctaactcaactggtaaaatgccgaaattgttaggcgggatgccatgatcggggttcgaaccc |
8374213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 10531385 - 10531461
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||| |||||||||||| |||||| ||||||||||||||||||||| |||| | |||||||||||||||| |
|
|
| T |
10531385 |
atccagaagttctagctcaactgacaaaatatcgaaattgttaggccggatgctatgatcggggttcgaaccccggt |
10531461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 14982783 - 14982711
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccc |
378 |
Q |
| |
|
||||| ||||||||||| ||||| |||||| ||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
14982783 |
atccacaagtcctagcttaactgccaaaataccgaaattgttaggccggatgccataaccgaggttcgaaccc |
14982711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 8116876 - 8116801
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
|||||| ||||||||||| |||||||||||| |||||||||||||||||||||| ||| ||| |||||||||||| |
|
|
| T |
8116876 |
tatccacaagtcctagcttaactggcaaaatatcgaaattgttaggccggatgccgtgatcggagttcgaaccccg |
8116801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 7098962 - 7099024
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||| || ||||||||||||||| |||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
7098962 |
atccacaactcctagctcaactggaaaaatgccgaaattgttaggccgggtgccatgatcggg |
7099024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 311 - 380
Target Start/End: Complemental strand, 24571742 - 24571672
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||| |||| ||||||| |||||||||||||| |
|
|
| T |
24571742 |
agaagtcctagctcaactgaaaaaatgtcgaaattgttaggccagatgtcatgaccagggttcgaaccccg |
24571672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 4128945 - 4129002
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||| ||| |||| |
|
|
| T |
4128945 |
tccagaagtcctagctcaactggtaaaataccgaaattgttaggccggacgccttgac |
4129002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 8977153 - 8977230
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||| ||||||||||||||||| |||| |||||||||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
8977153 |
atccacaagtcttagctcaactggcaaaaatgcccaaattgttaggccggatgtcatgatcggggttcgaaccccggt |
8977230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 319 - 382
Target Start/End: Complemental strand, 9949269 - 9949204
Alignment:
| Q |
319 |
tagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
9949269 |
tagctcaactggtaaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt |
9949204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 28322936 - 28323003
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
28322936 |
agaagtcctagctcaactggc-aaatgccgaaattgtaaggccggacgtcatgatccgggttcgaaccc |
28323003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 305 - 365
Target Start/End: Complemental strand, 30615043 - 30614983
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
|||| |||||||||||| |||| |||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
30615043 |
atattcagaagtcctagttcaattggcaaaatgtcgaaattgttaggctggatgccatgac |
30614983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 369
Target Start/End: Complemental strand, 2395683 - 2395624
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||| |||||| ||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
2395683 |
cagaagtcctaggtcaactagcaaaataacgaaattgttaggtcggatgccatgaccggg |
2395624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 29479427 - 29479502
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccg |
380 |
Q |
| |
|
|||||| || ||||| |||||||||||||||| |||||||||||||| ||||| ||| |||||| ||||||||||| |
|
|
| T |
29479427 |
tatccataactcctaactcaactggcaaaatgtcgaaattgttaggctggatgtcataaccgggattcgaaccccg |
29479502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 311 - 385
Target Start/End: Original strand, 34762671 - 34762746
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggtgcc |
385 |
Q |
| |
|
|||||| |||||||||||| ||||| |||||||| |||||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
34762671 |
agaagttctagctcaactgataaaatcccgaaattattaggccggacgccatgatcggggttcgaaccccggtgcc |
34762746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 2746454 - 2746524
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||| |||||| | ||||||| |||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
2746454 |
aagtcctatctcaaccgacaaaatgtcgaaattgttaggccggatgtcatgacaggggttcgaaccccggt |
2746524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 6556606 - 6556536
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||| ||||||||| ||| |||||||||||||||||||||||||| | |||| | |||||||||||||||| |
|
|
| T |
6556606 |
aagttctagctcaattggtaaaatgccgaaattgttaggccggattctatgatcggggttcgaaccccggt |
6556536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 1855008 - 1855081
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| | ||||||||||| || ||| |||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
1855008 |
agaagtcctagtttaactggcaaaaatgtcgatattgttaggccggatgccatgatcggggttcgaaccccggt |
1855081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 2236236 - 2236309
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| |||||||||||| ||| || |||||||||| ||||| |
|
|
| T |
2236236 |
cagaattcctagctcaactgacaaaatgccgaaattattaggccggatgtcataactggggttcgaactccggt |
2236309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 5626190 - 5626113
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||| |||| ||||||||||||||| |||||||||||||||||||| | ||| |||||| |||||||||||||||| |
|
|
| T |
5626190 |
tatctagaaatcctagctcaactggaaaaatgccgaaattgttaggtagtatgtcatgactggggttcgaaccccggt |
5626113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 310 - 359
Target Start/End: Complemental strand, 8487679 - 8487630
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgc |
359 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
8487679 |
cagaagtcttagctcaactggtaaaatgccgaaattgttaggccgaatgc |
8487630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 348
Target Start/End: Original strand, 26269248 - 26269285
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgtt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26269248 |
agaagtcctagctcaactggcaaaatgccgaaattgtt |
26269285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 308 - 379
Target Start/End: Original strand, 2711304 - 2711376
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaacccc |
379 |
Q |
| |
|
||||||||||||| ||||||||| ||||| |||||||||||||| |||| ||| |||| || ||||||||||| |
|
|
| T |
2711304 |
tccagaagtcctaactcaactggtaaaataccgaaattgttaggtcggacgccttgacgggagttcgaacccc |
2711376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 6453760 - 6453684
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||| ||||| |||| |||||| |||| ||||||||||| |
|
|
| T |
6453760 |
atccagaagtcctaactcaactaacaaaatgccgaaattgtcaggcctgatgtcatgactagggtccgaaccccggt |
6453684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 33621498 - 33621565
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
33621498 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
33621565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 33704220 - 33704287
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
33704220 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
33704287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 382
Target Start/End: Original strand, 5660427 - 5660474
Alignment:
| Q |
336 |
tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
5660427 |
tgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt |
5660474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 304 - 382
Target Start/End: Complemental strand, 23383188 - 23383109
Alignment:
| Q |
304 |
catatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||| |||||| ||||||||| |||||||||||| | |||| ||| | | |||||||||||||||| |
|
|
| T |
23383188 |
catattcagaagtcctagttcaactagcaaaatgctgaaattgttaggtcagatgtcataatcggggttcgaaccccggt |
23383109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 31063076 - 31063001
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||| ||||||| ||| |||||||||||||||||||||||| |||| ||| ||||||||||| |
|
|
| T |
31063076 |
tatccagaagtcctacctcaactaataaagtgccgaaattgttaggccggatgctatgattgggattcgaaccccg |
31063001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 365
Target Start/End: Complemental strand, 8795526 - 8795480
Alignment:
| Q |
319 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| || |||||| |
|
|
| T |
8795526 |
tagctcaactggaaaaatgccgaaattgttaggccgggtgtcatgac |
8795480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 305 - 376
Target Start/End: Complemental strand, 2018894 - 2018821
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactgg-caaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaac |
376 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||| | ||| |||||||| ||||||||| |
|
|
| T |
2018894 |
atatccagaagtcctagctcaactggtaaaaatgtcgaaattgttaggtcaaatgtcatgaccgtggttcgaac |
2018821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 322 - 382
Target Start/End: Original strand, 11152531 - 11152592
Alignment:
| Q |
322 |
ctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||| | ||||||| ||||||||| |||||||||||||||| ||||||||| |||||| |
|
|
| T |
11152531 |
ctcaactgaccaaatgccaaaattgttaagccggatgccatgaccggggttcgaatcccggt |
11152592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 385
Target Start/End: Original strand, 11548231 - 11548308
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggtgcc |
385 |
Q |
| |
|
|||| |||| |||||| |||||| ||||| |||||||||||||||||| | ||||||||||||||| |||| |||| |
|
|
| T |
11548231 |
tccaaaagttctagctgaactggtaaaattacgaaattgttaggccggaccctatgaccgggttcgaatcccgatgcc |
11548308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 356
Target Start/End: Complemental strand, 7974836 - 7974788
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
|||| |||||||| |||||||| ||||||||||||||||||||| |||| |
|
|
| T |
7974836 |
tccacaagtcctacctcaactgacaaaatgccgaaattgttaggtcgga |
7974788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 379
Target Start/End: Original strand, 9727499 - 9727567
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
||||||||| ||||||| ||||| || ||||||||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
9727499 |
aagtcctagttcaactgacaaaaatgtcgaaattgttaggccggataccatgatcggggttcgaacccc |
9727567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 380
Target Start/End: Original strand, 17546041 - 17546109
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||| || ||||||| ||||||||||||| |||||| ||||| ||| ||| |||||||| |
|
|
| T |
17546041 |
aagtcctagctcaattgacaaaatgtcgaaattgttaggtcggatgtcatgatcggagtttgaaccccg |
17546109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 21000696 - 21000763
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| | | ||||||| |||||||||||| |
|
|
| T |
21000696 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgtacgtcatgacctgggttcgaaccc |
21000763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 368
Target Start/End: Complemental strand, 10319010 - 10318955
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg |
368 |
Q |
| |
|
||||||||| ||||| | ||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
10319010 |
aagtcctagttcaacagacaaaatgtcgaaattgttaggttggatgccatgaccgg |
10318955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 382
Target Start/End: Complemental strand, 35164703 - 35164660
Alignment:
| Q |
340 |
gaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
35164703 |
gaaattgttaggccggatgccatgaccggggttcgaacaccggt |
35164660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 364
Target Start/End: Original strand, 10673252 - 10673302
Alignment:
| Q |
314 |
agtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| ||| ||| ||||| |
|
|
| T |
10673252 |
agtcctagctcaaccggtaaaatgccgaaattgttagaccgaatgtcatga |
10673302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 309 - 369
Target Start/End: Complemental strand, 1266870 - 1266809
Alignment:
| Q |
309 |
ccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||| |||||| || |||| ||||||||||||||||||||| | ||||| |||| |
|
|
| T |
1266870 |
ccagaagtcctaactcaaccggtaaaaatgccgaaattgttaggccggacgtcatgatcggg |
1266809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 313 - 354
Target Start/End: Complemental strand, 31340603 - 31340562
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccg |
354 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
31340603 |
aagtcctaactcaactgacaatatgccgaaattgttaggccg |
31340562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 310 - 367
Target Start/End: Complemental strand, 34182579 - 34182522
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg |
367 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||||||| ||||| |||||| ||| |||| |
|
|
| T |
34182579 |
cagaaatcctaactcagctggcaaaatgccgaaattattaggtcggatgtcataaccg |
34182522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 306 - 358
Target Start/End: Original strand, 15640515 - 15640567
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg |
358 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
15640515 |
tatccagaagtcatagctcaactggtaaaatgttaaaattgttaggtcggatg |
15640567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 69; Significance: 8e-31; HSPs: 122)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 48612516 - 48612592
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48612516 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
48612592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 35157215 - 35157137
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
35157215 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
35157137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 1573971 - 1573894
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1573971 |
tatccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
1573894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 378
Target Start/End: Complemental strand, 3497647 - 3497574
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3497647 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
3497574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 4106552 - 4106629
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4106552 |
tatccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
4106629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 378
Target Start/End: Complemental strand, 4887643 - 4887570
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4887643 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccc |
4887570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 35849293 - 35849370
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35849293 |
tatccagaagtcctagctcaactggcaaagtgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
35849370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 19306711 - 19306787
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19306711 |
atccagaagtcctagctcaactggcaaaatgccgaaattattaggccggatgccatgaccggggttcgaaccccggt |
19306787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 2354927 - 2354852
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
2354927 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggagttcgaaccccg |
2354852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 45236928 - 45237003
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
45236928 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccg |
45237003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 4069247 - 4069169
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4069247 |
atatccagaagtcctaactcaactggcaaaataccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
4069169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 308 - 385
Target Start/End: Complemental strand, 6384646 - 6384569
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggtgcc |
385 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
6384646 |
tccagaagtcctagctcaactggtaaaataccgaaattgttaggccggacgccatgacggggttcgaaccccggtgcc |
6384569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 17895632 - 17895709
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17895632 |
tatcctgaagtcctagctcaactggcaaaatgctgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
17895709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 47584801 - 47584724
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47584801 |
tatccagaagtcctagctcaactggcaaaatgtcgacattgttaggccggatgccatgaccggggttcgaaccccggt |
47584724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 305 - 369
Target Start/End: Original strand, 6596539 - 6596603
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6596539 |
atatccagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggg |
6596603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 10061145 - 10061069
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
10061145 |
atccacaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggt |
10061069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 31717296 - 31717372
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
31717296 |
atccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaactccggt |
31717372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 308 - 382
Target Start/End: Complemental strand, 27396442 - 27396367
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27396442 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgattggggttcgaaccccggt |
27396367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 40013260 - 40013339
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40013260 |
atatccagaagtcctagctcaactgacaaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggt |
40013339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 306 - 379
Target Start/End: Original strand, 9379989 - 9380063
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
9379989 |
tatccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaacccc |
9380063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 21226070 - 21226140
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21226070 |
aagtcctatctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
21226140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 7312579 - 7312506
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
7312579 |
cagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
7312506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 311 - 376
Target Start/End: Original strand, 10166873 - 10166938
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaac |
376 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10166873 |
agaagtcctagctcaactgataaaatgccgaaattgttaggccggatgccatgaccgggttcgaac |
10166938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 29151581 - 29151658
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| | |||||||||||||||| |
|
|
| T |
29151581 |
tatccagaagtcctagctcaactggcaaaatgctgaaattgttaggccggatgctatgatcggggttcgaaccccggt |
29151658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 33228698 - 33228775
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33228698 |
atccagaagtcctagctcaactggcaaaaatgtcgaaattgttaggccggatgccatgaccgaggttcgaaccccggt |
33228775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 1323682 - 1323754
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
1323682 |
atccagaagtcctagctcaactggcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaaccc |
1323754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 319 - 382
Target Start/End: Original strand, 5508696 - 5508760
Alignment:
| Q |
319 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5508696 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
5508760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 40809044 - 40809116
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
40809044 |
atccagaagtcctagctcaactggcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaaccc |
40809116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 45041862 - 45041786
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
45041862 |
atccagaagtcttagctcaactggcaaaatgccgaaattgttaggtcggatgccttgaccggggttcgaaccccggt |
45041786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 378
Target Start/End: Original strand, 18944921 - 18944995
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
18944921 |
atatccagaagtcctagttcaactggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccc |
18944995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 19258426 - 19258499
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||| |||||||| | ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19258426 |
cagaagtcctggctcaactagaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
19258499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 40656241 - 40656161
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40656241 |
atatctagaagtcctagctcaactggcaaaaaatgccgatattgttaggccggatgccatgaccggggttcgaaccccggt |
40656161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 307 - 364
Target Start/End: Complemental strand, 48729813 - 48729756
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48729813 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatga |
48729756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 2228209 - 2228133
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||| |||||| |
|
|
| T |
2228209 |
atccagaagtcgtagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggt |
2228133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 6327210 - 6327286
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6327210 |
atccagaagtcctaactcaactgacaaaatgcaaaaattgttaggccggatgccatgaccggggttcgaaccccggt |
6327286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 31300126 - 31300050
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||| ||||||||||| |||| |
|
|
| T |
31300126 |
atccagaagtcctagctaaactggcaaaatgccgaaattgttaagccggatgtcatgaccggggttcgaacctcggt |
31300050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 33628027 - 33628099
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
33628027 |
atccagaagtcctagctcaactgacaaagtgccgaaattgttaagccggatgccatgaccagggttcgaaccc |
33628099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 367
Target Start/End: Original strand, 46416548 - 46416608
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg |
367 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46416548 |
atccagaagtcctaggtcaactggcaaaatgccgacattgttaggccggatgccatgaccg |
46416608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 47182802 - 47182878
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||| | |||||||||||||||| |
|
|
| T |
47182802 |
atccataagtcctagctcaactggcaaaatgccaaaattgttagaccggatgccatgatcagggttcgaaccccggt |
47182878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 2286222 - 2286148
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||| |||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
2286222 |
atccaaaagtcctagctcaactgacaaaatgccaaaattgttaggccggatgccatgaccagagttcgaaccccg |
2286148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 317 - 382
Target Start/End: Original strand, 16816700 - 16816766
Alignment:
| Q |
317 |
cctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
16816700 |
cctagttcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccgcggt |
16816766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 32251464 - 32251390
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| | |||||| ||||||| |||||||||||||| |
|
|
| T |
32251464 |
atccagaagtcctagttcaactggcaaaatgccgaaattgttaagtcggatgtcatgaccggggttcgaaccccg |
32251390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 34708671 - 34708749
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
34708671 |
tatctagaagtcctagctcaactggcaaaaatgccgatattgttaggctggatgccatgaccggggttcgaaccccggt |
34708749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 42557631 - 42557569
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42557631 |
atccataagtcctagctcaattggcaaaatgccgaaattgttaggccggatgccatgatcggg |
42557569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 1869818 - 1869891
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
1869818 |
agaagtcctagctcaactggcaaaaatgccgatattgttaggccggatgccatgaccggggttcgaactccggt |
1869891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 378
Target Start/End: Complemental strand, 37410832 - 37410759
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccc |
378 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
37410832 |
tatctagaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgtcatgactggggttcgaaccc |
37410759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 310 - 367
Target Start/End: Original strand, 38261003 - 38261060
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg |
367 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38261003 |
cagaagtcctagctcaactgacaaaatgtcgaaattgttaggccggatgccatgaccg |
38261060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 40857470 - 40857393
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||| ||| |||||| ||||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
40857470 |
tatccagaagtcctagctcaaatggtaaaatgtcgaaattgttaggtcggatgccatgatcggggttcgaaccccggt |
40857393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 3861465 - 3861389
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||||||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
3861465 |
atccagaagtcctagtttaactggcaaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggt |
3861389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 325 - 382
Target Start/End: Complemental strand, 1582727 - 1582669
Alignment:
| Q |
325 |
aactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
1582727 |
aactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggt |
1582669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 13769746 - 13769676
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||| ||||||||||| ||||||||||||| |
|
|
| T |
13769746 |
aagtcctagctcaattggcaaaatgccgaaattgttgggccggactccatgaccgggattcgaaccccggt |
13769676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 26794909 - 26794987
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||| |||||||||| |||||||||||||| |||||||||| ||||| |
|
|
| T |
26794909 |
atatccacaagtcctagctcaaccggcaaaatgccaaaattgttagatcggatgccatgaccggggttcgaactccggt |
26794987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 29628515 - 29628437
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||| ||||| |||||||||||| | ||||||||| |||||| |
|
|
| T |
29628515 |
atatctagaagtcctagctcaactggaaaaatgccgaaattattaggtcggatgccatgatcagggttcgaatcccggt |
29628437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 313 - 359
Target Start/End: Original strand, 33512802 - 33512848
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgc |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33512802 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgc |
33512848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 306 - 368
Target Start/End: Original strand, 44327638 - 44327700
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg |
368 |
Q |
| |
|
||||||||| |||||||||||||||||||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
44327638 |
tatccagaattcctagctcaactggcaaaatgtcaaaattgttaggccggatgtcatgaccgg |
44327700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 4674435 - 4674362
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | | ||| ||||||| |||||||||||||||| |
|
|
| T |
4674435 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaagtcagatatcatgaccggggttcgaaccccggt |
4674362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 23789539 - 23789470
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23789539 |
agaagtcctagttcaactggcaaaaatgccgatattgttaggccggatgccatgaccggggttcgaaccc |
23789470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 10422477 - 10422553
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||| | ||||||||| |||||| |
|
|
| T |
10422477 |
atccagaagtcttagctcaactggcaaaatatcgaaattgttaggtcggatgccatgatcggggttcgaatcccggt |
10422553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 310 - 385
Target Start/End: Complemental strand, 12014858 - 12014782
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc |
385 |
Q |
| |
|
||||||||||| ||||||||| ||||| |||||||||||||||| || ||| ||||| ||||||||||||||||||| |
|
|
| T |
12014858 |
cagaagtcctaactcaactggtaaaataccgaaattgttaggccagacgccttgaccggggttcgaaccccggtgcc |
12014782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 37919972 - 37920044
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| | |||||||||||| || ||||||||||||| |
|
|
| T |
37919972 |
agaagtcctagctcaactggcaaaatatcgaaattgttaggtcagatgccatgacctggattcgaaccccggt |
37920044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 8946452 - 8946503
Alignment:
| Q |
332 |
aaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8946452 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
8946503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 306 - 369
Target Start/End: Complemental strand, 37117975 - 37117912
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||| |||| |
|
|
| T |
37117975 |
tatccagaagtcctagctcaactgacaaaatgttgaaattgttaggtcggatgccatgatcggg |
37117912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 312 - 382
Target Start/End: Original strand, 40873190 - 40873261
Alignment:
| Q |
312 |
gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||| ||||||||||| || |||||||||||||| |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
40873190 |
gaagacctagctcaaccggtaaaatgccgaaattattaggctggatgccatgaccggggttcgaaccccggt |
40873261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 46021555 - 46021484
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
46021555 |
aagtcctagctcaactgataaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
46021484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 48467810 - 48467881
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccc |
378 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||| ||||||| ||||| |||||||||||| |
|
|
| T |
48467810 |
atccagaaatcctagctcaactggcaaaatatcgaaattgttagaccggatgttatgacggggttcgaaccc |
48467881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 305 - 378
Target Start/End: Original strand, 41780260 - 41780334
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||| ||||||||||||| ||||| ||||||| |||||||||||| |
|
|
| T |
41780260 |
atatccagaagtcctaactcaactagcaaaatgtcgaaattgttaggttggatgtcatgaccggggttcgaaccc |
41780334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 379
Target Start/End: Original strand, 43188528 - 43188602
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgac-cgggttcgaacccc |
379 |
Q |
| |
|
|||||||||| ||||||||| |||||||| ||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
43188528 |
atccagaagtactagctcaagtggcaaaaatgccgaaattgttaggccgcatgccatgactagggttcgaacccc |
43188602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 45946707 - 45946785
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||| ||||| |||||||||||||||| || || ||||||||| |||| |
|
|
| T |
45946707 |
atatccaaaagtcctagctcaactgacaaaatgccaaaattattaggccggatgccattactggagttcgaacctcggt |
45946785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 306 - 378
Target Start/End: Complemental strand, 47086431 - 47086357
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
47086431 |
tatccataagtcctagctcaactgacaaaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccc |
47086357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 4227336 - 4227409
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| ||||| || ||||| |||||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
4227336 |
cagaagtcctagatcaaccggtaaaataccgaaattgttaggtcggatgccatgatcggggttcgaaccccggt |
4227409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 43416413 - 43416340
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||| |||||||||||||| |||||| ||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
43416413 |
agaagttctaactcaactggcaaaaatgccgatattgttaggccggataccatgaccggggttcgaaccccggt |
43416340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 31770656 - 31770589
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||| ||||| |||||||||||||| |
|
|
| T |
31770656 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggatgtcatgacccgggttcgaaccc |
31770589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 305 - 349
Target Start/End: Complemental strand, 36280056 - 36280012
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgtta |
349 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36280056 |
atatctagaagtcctagctcaactggcaaaatgccgaaattgtta |
36280012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 41862786 - 41862862
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||| | || |||||||||| ||||||||||||| |||||| ||| ||| |||||||||||||||| |
|
|
| T |
41862786 |
atccagaagtcctagtttaattggcaaaatgtcgaaattgttaggtcggatgtcataaccggggttcgaaccccggt |
41862862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 43723311 - 43723387
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| ||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
43723311 |
atccacaagtcctagctcgactggcaaaatgccaaaattgttaagccggatgtcatgattggggttcgaaccccggt |
43723387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 367
Target Start/End: Original strand, 47459415 - 47459475
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg |
367 |
Q |
| |
|
||||| ||||| |||||||||||| |||||| |||||||||||||||||||| |||||||| |
|
|
| T |
47459415 |
atccaaaagtcatagctcaactggtaaaatgtcgaaattgttaggccggatgtcatgaccg |
47459475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 305 - 352
Target Start/End: Complemental strand, 788977 - 788930
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggc |
352 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
788977 |
atatccagaagccctagctcaactgacaaaatgccgaaattgttaggc |
788930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 318 - 369
Target Start/End: Complemental strand, 10084417 - 10084366
Alignment:
| Q |
318 |
ctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||| | |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10084417 |
ctagctcaactagaaaaatgccgaaattgttaagccggatgccatgaccggg |
10084366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 369
Target Start/End: Complemental strand, 19563221 - 19563162
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||| ||||||||||| | |||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
19563221 |
cagaagttctagctcaactagtaaaatgccgaaattgttaggtcggatgccatgatcggg |
19563162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 306 - 379
Target Start/End: Complemental strand, 5222703 - 5222629
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||| | ||||| ||||| | ||||||||||||| |
|
|
| T |
5222703 |
tatccagaagtcctaactcaactggtaaaatgccgaaattgttaagttggatgtcatgatcggggttcgaacccc |
5222629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 308 - 382
Target Start/End: Complemental strand, 9234377 - 9234300
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||| |||||||||||||||||| |||| ||||||||||||||||||||| || |||||||| ||||||| |||||| |
|
|
| T |
9234377 |
tccacaagtcctagctcaactggaaaaaaatgccgaaattgttaggccggacgctatgaccggagttcgaatcccggt |
9234300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 316 - 354
Target Start/End: Complemental strand, 10704011 - 10703973
Alignment:
| Q |
316 |
tcctagctcaactggcaaaatgccgaaattgttaggccg |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10704011 |
tcctagctcaactggcaaaatgccgaaattgttaggccg |
10703973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 46274945 - 46275023
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||| |||| |||||||||| || |||| |||||||||||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
46274945 |
tatccataagttctagctcaaccggtaaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaatcccggt |
46275023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 318 - 378
Target Start/End: Original strand, 14817437 - 14817498
Alignment:
| Q |
318 |
ctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||| |||||| | |||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
14817437 |
ctagctcaactgggaaaatgtcaaaattgttaggccggatgccatgatcggggttcgaaccc |
14817498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 318 - 378
Target Start/End: Original strand, 15264433 - 15264494
Alignment:
| Q |
318 |
ctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||| |||||| | |||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
15264433 |
ctagctcaactgggaaaatgtcaaaattgttaggccggatgccatgatcggggttcgaaccc |
15264494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 306 - 367
Target Start/End: Original strand, 20350260 - 20350321
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg |
367 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||| || |||| ||||||| |
|
|
| T |
20350260 |
tatccagaagtcctaactcaattggcaaaatgccgaaattgttagaccaaatgctatgaccg |
20350321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 313 - 378
Target Start/End: Complemental strand, 26336502 - 26336437
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccc |
378 |
Q |
| |
|
|||| ||||||||||||| |||||| |||||||||| || ||||| ||||||||||||||||||| |
|
|
| T |
26336502 |
aagttctagctcaactggtaaaatggtgaaattgttaagctggatgtcatgaccgggttcgaaccc |
26336437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 313 - 364
Target Start/End: Original strand, 6369533 - 6369584
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||| ||| ||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
6369533 |
aagttctaactcaactggtaaaatgccgaaattgttaggccggatgtcatga |
6369584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 313 - 364
Target Start/End: Original strand, 6377998 - 6378049
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||| ||| ||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
6377998 |
aagttctaactcaactggtaaaatgccgaaattgttaggccggatgtcatga |
6378049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 307 - 358
Target Start/End: Original strand, 23138648 - 23138699
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg |
358 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| |||||||||||| |||||| |
|
|
| T |
23138648 |
atccagaagtcctagcttaactggtaaaatgctgaaattgttaggtcggatg |
23138699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 43133227 - 43133156
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| |||||||| | ||||||||||||||| | ||| ||||||| |||||||||||||||| |
|
|
| T |
43133227 |
aagtcctagctcaaatggcaaaaataccgaaattgttaggctgaatgtcatgaccggggttcgaaccccggt |
43133156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 311 - 377
Target Start/End: Complemental strand, 47250375 - 47250309
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacc |
377 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| ||||||||||||| |
|
|
| T |
47250375 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacc |
47250309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 307 - 353
Target Start/End: Complemental strand, 5110881 - 5110835
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggcc |
353 |
Q |
| |
|
||||||| ||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
5110881 |
atccagacgtcttagctcaactggtaaaatgccgaaattgttaggcc |
5110835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 5523792 - 5523854
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||| ||||||| |||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
5523792 |
atccagaagtcctgactcaactaataaaatgtcgaaattgttaggtcggatgccatgaccggg |
5523854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 310 - 364
Target Start/End: Original strand, 24382593 - 24382647
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
||||||| ||||||||||||| ||||| |||||||||||||| ||||||| |||| |
|
|
| T |
24382593 |
cagaagttctagctcaactggtaaaataccgaaattgttaggtcggatgctatga |
24382647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 311 - 369
Target Start/End: Complemental strand, 38678288 - 38678230
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||| |||||| | ||||||||||||||| |
|
|
| T |
38678288 |
agaagtcctagctcaattggcaaaatgtagaaatagttaggtcagatgccatgaccggg |
38678230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 307 - 375
Target Start/End: Original strand, 7264404 - 7264473
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaa |
375 |
Q |
| |
|
||||| || ||||| |||||||| ||||||||||||||||| ||| ||||||| ||||||| |||||||| |
|
|
| T |
7264404 |
atccacaaatcctaactcaactgacaaaatgccgaaattgtgaggtcggatgctatgaccgaggttcgaa |
7264473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 307 - 379
Target Start/End: Complemental strand, 22752963 - 22752890
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
||||| |||||||||||||||| | ||||| ||||||||| ||||||||||| |||| | ||||||||||||| |
|
|
| T |
22752963 |
atccataagtcctagctcaactagaaaaatatcgaaattgtaaggccggatgctatgatcggggttcgaacccc |
22752890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 369
Target Start/End: Original strand, 28234926 - 28234987
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||| ||||| |||||||| |||||||||||||| |||||||||||||| | ||| |||||| |
|
|
| T |
28234926 |
tccacaagtcttagctcaattggcaaaatgccgatattgttaggccggacgtcataaccggg |
28234987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 323 - 364
Target Start/End: Original strand, 28382604 - 28382645
Alignment:
| Q |
323 |
tcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
28382604 |
tcaactggcaaaatgccgaaattgttaggtcggatgtcatga |
28382645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 313 - 365
Target Start/End: Original strand, 35196879 - 35196932
Alignment:
| Q |
313 |
aagtcctagctcaact-ggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
35196879 |
aagtcctagctcaacaaggcaaaatgccgaaatcgttaggctggatgccatgac |
35196932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 990218 - 990286
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||| ||||||||||| || |||| | ||||||||||||||||||| |||| | |||||||||||| |
|
|
| T |
990218 |
agaagtcttagctcaactgacataatggcaaaattgttaggccggatgctatgatcggggttcgaaccc |
990286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 4106742 - 4106809
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
4106742 |
agaagtcctagcccaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
4106809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 330 - 377
Target Start/End: Original strand, 10092696 - 10092744
Alignment:
| Q |
330 |
gcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacc |
377 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
10092696 |
gcaaaatgccgaaattattaggccggatgtcatgaccagggttcgaacc |
10092744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 305 - 379
Target Start/End: Complemental strand, 46715822 - 46715746
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
||||| |||||||||| |||||||| |||| || |||||||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
46715822 |
atatctagaagtcctaactcaactgaaaaaaatgtcgaaattgttaggcagaatgccatgaccggggttcgaacccc |
46715746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 310 - 380
Target Start/End: Complemental strand, 3043942 - 3043871
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||| || |||||| ||||||||||||||||||| ||||| || |||||||||||| |
|
|
| T |
3043942 |
cagaagtcctagctcaattgataaaatgttgaaattgttaggccggatgtcatgattggagttcgaaccccg |
3043871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 356
Target Start/End: Complemental strand, 7162910 - 7162868
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
7162910 |
aagtcctagctcaactggc-aaatgccgaaattgtaaggccgga |
7162868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 323 - 366
Target Start/End: Complemental strand, 31807160 - 31807117
Alignment:
| Q |
323 |
tcaactggcaaaatgccgaaattgttaggccggatgccatgacc |
366 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||| |||||| |
|
|
| T |
31807160 |
tcaactggcaaaatgccgaaattattaggccagatgctatgacc |
31807117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 308 - 378
Target Start/End: Complemental strand, 43753881 - 43753811
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| |||||||| | | ||||| |||||||||||| |
|
|
| T |
43753881 |
tccagaagtcctagttcaactggc-aaatgccgaaattgcaaggccggacgtcgtgacctgggttcgaaccc |
43753811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 379
Target Start/End: Original strand, 45350625 - 45350692
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
|||||||| |||||||| |||||||| ||||| ||||| ||||||||||| | | ||||||||||||| |
|
|
| T |
45350625 |
aagtcctatctcaactgacaaaatgctgaaatagttagtccggatgccataatcggggttcgaacccc |
45350692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 325 - 378
Target Start/End: Complemental strand, 9932289 - 9932235
Alignment:
| Q |
325 |
aactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccc |
378 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||| ||| |||||||||| |
|
|
| T |
9932289 |
aactggtaaaatgccgaaattgttaggttggatgccatgatcggagttcgaaccc |
9932235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 30627621 - 30627699
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
||||| || ||||||||||||||| | |||||| |||||||||||| |||||| ||||| || ||||||||||||||| |
|
|
| T |
30627621 |
tatcctgatgtcctagctcaactgacaaaaatgtcgaaattgttagatcggatgtcatgatcgaggttcgaaccccggt |
30627699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 301 - 358
Target Start/End: Original strand, 46034303 - 46034361
Alignment:
| Q |
301 |
tcacatatccagaagtcctagctcaactggcaaaatgccgaaa-ttgttaggccggatg |
358 |
Q |
| |
|
|||| |||||| ||||||||| ||||||| |||||||| |||| ||||||||||||||| |
|
|
| T |
46034303 |
tcacttatccataagtcctagttcaactgacaaaatgctgaaaattgttaggccggatg |
46034361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 2146640 - 2146684
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
2146640 |
agaagtcctagctcaactgg-aaaatgccgaaattgcaaggccgga |
2146684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 375
Target Start/End: Complemental strand, 25546399 - 25546335
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaa |
375 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||| | ||||| ||||||||||| |
|
|
| T |
25546399 |
agaagtcctagctcaactgg-taaatgccgaaattgcaaggccggacgtcatgacccgggttcgaa |
25546335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 364
Target Start/End: Complemental strand, 28649491 - 28649438
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||| ||||||||||||||| ||||| ||||||||||||| |||||| ||||| |
|
|
| T |
28649491 |
agaaatcctagctcaactggtaaaatagcgaaattgttaggtcggatgtcatga |
28649438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 307 - 352
Target Start/End: Complemental strand, 38930407 - 38930362
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggc |
352 |
Q |
| |
|
|||||||||||||||||||| ||||||| || | |||||||||||| |
|
|
| T |
38930407 |
atccagaagtcctagctcaattggcaaagtgtcaaaattgttaggc |
38930362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 313 - 380
Target Start/End: Complemental strand, 46734240 - 46734171
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
|||||||| ||||| |||||||| || |||||||||||||| ||||| ||||| | |||||||||||||| |
|
|
| T |
46734240 |
aagtcctaactcaattggcaaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccg |
46734171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 339 - 378
Target Start/End: Original strand, 8856308 - 8856348
Alignment:
| Q |
339 |
cgaaattgttaggccggatgccatgaccgg-gttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
8856308 |
cgaaattgttaggccggataccatgaccggagttcgaaccc |
8856348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 25112371 - 25112304
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| ||| |||| | ||||||| |||||||||||| |
|
|
| T |
25112371 |
agaagtcctagctcaactggc-aaataccgaaattgcaaggtcggacgtcatgacctgggttcgaaccc |
25112304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 313 - 356
Target Start/End: Complemental strand, 38504647 - 38504603
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccgga |
356 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| |||||||||| |
|
|
| T |
38504647 |
aagtcctagctcaattggcaaaaatgccgaaatttttaggccgga |
38504603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 43203310 - 43203377
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||| | |||||||||| |||||||||||| |||| ||| ||| ||| |||||||||||||| |
|
|
| T |
43203310 |
agaagtcctagatgaactggcaaa-tgccgaaattgtaaggcgggacgccgtgacccgggttcgaaccc |
43203377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 69; Significance: 8e-31; HSPs: 142)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 6672240 - 6672316
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6672240 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
6672316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 17869253 - 17869177
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17869253 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
17869177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 18473913 - 18473989
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18473913 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
18473989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 23311302 - 23311226
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23311302 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
23311226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 36569278 - 36569354
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36569278 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
36569354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 25328435 - 25328357
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25328435 |
atatctagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggt |
25328357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 2103024 - 2103101
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
2103024 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcgggattcgaaccccggt |
2103101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 4164957 - 4165034
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
4164957 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
4165034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 385
Target Start/End: Original strand, 21728658 - 21728739
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21728658 |
tatccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcc |
21728739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 28143362 - 28143285
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28143362 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccccggt |
28143285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 42448209 - 42448286
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42448209 |
tatccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
42448286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 1244310 - 1244238
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1244310 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
1244238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 36726987 - 36727062
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
36726987 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggt-gaaccccggt |
36727062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 41562457 - 41562533
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
41562457 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggagttcgaactccggt |
41562533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 9054100 - 9054026
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9054100 |
atccagaagtcctagctcaactggcaaaataccgaaattgttaggccggatgccatgaccggggttcgaaccccg |
9054026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 23074774 - 23074697
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23074774 |
atccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
23074697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 310 - 378
Target Start/End: Original strand, 29119608 - 29119677
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29119608 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
29119677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 39151056 - 39150979
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39151056 |
tatccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
39150979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 42068539 - 42068616
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
42068539 |
tatccagaagtcctagctcagctggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggt |
42068616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 4617895 - 4617819
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4617895 |
atccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
4617819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 16496599 - 16496675
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16496599 |
atccagaagtcctagttcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
16496675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 24652445 - 24652367
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
24652445 |
atatccagaagtcctaactcaactggcaaaatgtcgaaattgttaggccggatgccatgaccgggatttgaaccccggt |
24652367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 309 - 382
Target Start/End: Original strand, 38682929 - 38683003
Alignment:
| Q |
309 |
ccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
38682929 |
ccagaagtcctagctcaactggcaaaatgccaaaattgttaggctggatgccatgaccggggttcgaaccccggt |
38683003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 9902627 - 9902554
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||| |
|
|
| T |
9902627 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgatcggggttcgaaccccggt |
9902554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 1650290 - 1650366
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
1650290 |
atccagaagtcctagctcaacctgcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaactccggt |
1650366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 319 - 382
Target Start/End: Original strand, 34930236 - 34930300
Alignment:
| Q |
319 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34930236 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
34930300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 36136991 - 36136915
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||| |||||| |||||||||||||||| |
|
|
| T |
36136991 |
atccagaagtcctagctcaactagcaaaatgccgaaattgttaggccgaatgctatgaccggggttcgaaccccggt |
36136915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 12878248 - 12878173
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||| |
|
|
| T |
12878248 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcgaagttcgaaccccg |
12878173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 37067699 - 37067774
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
|||| |||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37067699 |
tatctagaagtcctacctcaactgacaaaatgccgaaattgttaggccggatgccatgaccggagttcgaaccccg |
37067774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 1269650 - 1269572
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1269650 |
atatccagaagtcctagctcaactgacaaaatgtcgaaattgttaggccggatgccatgattggggttcgaaccccggt |
1269572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 306 - 379
Target Start/End: Original strand, 11968774 - 11968848
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11968774 |
tatccagaagtcctaactcaactgtcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaacccc |
11968848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 307 - 365
Target Start/End: Complemental strand, 22620780 - 22620722
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22620780 |
atccagaagtcctagctcaactgacaaaatgccgaaattgttaggccggatgccatgac |
22620722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 311 - 380
Target Start/End: Original strand, 37940921 - 37940991
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
37940921 |
agaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccccg |
37940991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 10393628 - 10393555
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
10393628 |
cagaagtcctagctcaactggaaaaatgccgaaattattaggccggatgccttgaccggggttcgaaccccggt |
10393555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 12665093 - 12665170
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
12665093 |
tatccagaagtcctagttcaactgacaaaatgccgaaattattaggccggatgccatgaccggggttcgaactccggt |
12665170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 307 - 379
Target Start/End: Complemental strand, 12708005 - 12707932
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| | ||||||||||| |
|
|
| T |
12708005 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatcaccagagttcgaacccc |
12707932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 23310398 - 23310475
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| | |||| ||||||||| |
|
|
| T |
23310398 |
tatccagaagtcctagctcaactggcaaaataccaaaattgttaggccggatgccatgaccagagttcaaaccccggt |
23310475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 29806565 - 29806642
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29806565 |
tatccagaaatcctagctcaactggtaaaatgccaaaattgttaggccggatgccatgactggggttcgaaccccggt |
29806642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 39143439 - 39143512
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccc |
378 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
39143439 |
tatccacaagtcctagctcaactggcaaaatgtcgaaattgttaggccgaatgccatgaccgaggttcgaaccc |
39143512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 39527934 - 39528007
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
39527934 |
cagaagtcctagttcaactggtaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggt |
39528007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 1287314 - 1287390
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
1287314 |
atccagaagtcctagctcaattggtaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt |
1287390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 6041973 - 6041897
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||| ||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
6041973 |
atccagaagtcctagctcaactggtaaaatgtcgaaattattaggccggatgctatgaccgggattcgaaccccggt |
6041897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 6053176 - 6053104
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
6053176 |
agaagtcctagctcaactgacaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt |
6053104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 10154287 - 10154215
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
10154287 |
agaagtcctaactcaactgacaaaatgccgaaattgtcaggccggatgccatgaccggggttcgaaccccggt |
10154215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 14107251 - 14107327
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14107251 |
atccacaagtcctagctcaattggtaaaatgccgaaactgttaggccggatgccatgaccggggttcgaaccccggt |
14107327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 319 - 382
Target Start/End: Original strand, 16906348 - 16906412
Alignment:
| Q |
319 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
16906348 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt |
16906412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 26267130 - 26267054
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
26267130 |
atccagaagtcgtagctcaactggcaaaatgccgaaattgttaagccggatgccatgatcggatttcgaaccccggt |
26267054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 34675746 - 34675822
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
34675746 |
atccagaagtcctagctcaacaggcaaaatgccgaaattgttaggttggatgccatgatcgggattcgaaccccggt |
34675822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 36319631 - 36319555
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36319631 |
atccaaaagtcctagctcaactggcaaaatactgaaattgttaggccggatgccatgacaggggttcgaaccccggt |
36319555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 671189 - 671114
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |||||| ||||| | |||||||||||||| |
|
|
| T |
671189 |
tatccagaagtcctagttcaactggcaaaatgccgaaattgttaggtcggatgtcatgatcggggttcgaaccccg |
671114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 1833449 - 1833374
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
1833449 |
atccagaagtcatagctcaactggcaaaaatgccgaaattgttaggccggataccatgaccggggttcgaaccccg |
1833374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 40318915 - 40318840
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
40318915 |
atccagaagtcatagctcaactggcaaaaatgccgaaattgttaggccggataccatgaccggggttcgaaccccg |
40318840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 7179430 - 7179368
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
7179430 |
atccagaagttctagctcaactggcaaaatgtcgaaattgttaggccagatgccatgaccggg |
7179368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 325 - 382
Target Start/End: Complemental strand, 36854269 - 36854211
Alignment:
| Q |
325 |
aactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36854269 |
aactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
36854211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 40595962 - 40596031
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
40595962 |
aagtcctagctcaactggcaaaatgccgaaattgttaggcc-gatgccatgactggggttcgaaccccggt |
40596031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 9068801 - 9068878
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||| |||||||||||||||||| |||||| ||||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
9068801 |
tatccataagtcctagctcaactggtaaaatgtcgaaattgttaggtcggatgccatgatcggggttcgaaccccggt |
9068878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 14808833 - 14808910
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
14808833 |
tatccagaagtcctaattcaactggcaaaatgccaaaattgttaggccggatcccatgaccagggttcgaactccggt |
14808910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 382
Target Start/End: Complemental strand, 27390041 - 27389980
Alignment:
| Q |
322 |
ctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
27390041 |
ctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaacctcggt |
27389980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 33028228 - 33028305
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||| ||||||||||| ||||||| ||||||||| |||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
33028228 |
tatcaagaagtcctagttcaactgacaaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
33028305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 314 - 382
Target Start/End: Original strand, 37191250 - 37191319
Alignment:
| Q |
314 |
agtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
37191250 |
agtcctagctcaactggcaaaatgccaaaattgttaggctggatgccatgatcgggattcgaaccccggt |
37191319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 307 - 375
Target Start/End: Complemental strand, 40045045 - 40044976
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaa |
375 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
40045045 |
atccagaagttctagctcagctggcaaaatgccgaaattgttaggtcggatgccatgaccagggttcgaa |
40044976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 305 - 369
Target Start/End: Complemental strand, 4444978 - 4444915
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
4444978 |
atatccagaagtcctagctcaactggc-aaatgccgaaattgttaggctggataccatgaccggg |
4444915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 6029611 - 6029687
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||| |||| | |||||||||||||||| |
|
|
| T |
6029611 |
atccagaagtcctagctcaactggcaaaatgtcaaaattgttaggccggatgtcatgcctggggttcgaaccccggt |
6029687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 10165531 - 10165607
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||| ||||| ||||||||||||||||||||||| ||||||||||||| | |||||||||||||||| |
|
|
| T |
10165531 |
atccataagtcctaactcaattggcaaaatgccgaaattgttagaccggatgccatgatcggggttcgaaccccggt |
10165607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 304 - 379
Target Start/End: Complemental strand, 18625747 - 18625671
Alignment:
| Q |
304 |
catatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||| || |||||||||| | ||||||||||||| |
|
|
| T |
18625747 |
catatccagaagtcctaactcaactggcaaaatgccaaaattgttagtccagatgccatgatcggggttcgaacccc |
18625671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 24051402 - 24051474
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
24051402 |
atccagaagtcctaactcaactggcaaaatgctaaaattattaggccggatgccatgaccggggttcgaaccc |
24051474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 24443996 - 24443920
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||| |||||| |||||| ||||||||| |
|
|
| T |
24443996 |
atccagaagtcctagctcaactggcaaaataccgaaattgttaggtcggatgttatgaccggggttcaaaccccggt |
24443920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 26802333 - 26802409
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| || |||||||||||||||||| |||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
26802333 |
atccagaagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggt |
26802409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 26809883 - 26809959
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| || |||||||||||||||||| |||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
26809883 |
atccagaagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggt |
26809959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 26824910 - 26824986
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| || |||||||||||||||||| |||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
26824910 |
atccagaagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggt |
26824986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 33617095 - 33617171
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
33617095 |
atccagaagtcctagctcaactggtaaaatgccgacattgttaggccggatgctatgattggggttcgaaccccggt |
33617171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 320 - 382
Target Start/End: Original strand, 34856592 - 34856656
Alignment:
| Q |
320 |
agctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34856592 |
agctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
34856656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 36790447 - 36790368
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||| ||||||||||| |||||||||| ||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
36790447 |
atatctagaagtcctagcttaactggcaaaaatgccgaaattattaggccggatgctatgaccggggttcgaaccccggt |
36790368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 307 - 380
Target Start/End: Original strand, 41408625 - 41408700
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
41408625 |
atccagaagtcatagctcaactggcaaaaatgccgaaattgttaggccggataccataaccggggttcgaaccccg |
41408700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 43070807 - 43070737
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||| |
|
|
| T |
43070807 |
aagtactagcttaactggcaaaatgccgaaattgttaggtcggatgccatgacggaggttcgaaccccggt |
43070737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 307 - 379
Target Start/End: Complemental strand, 12769254 - 12769181
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||| |||||||||| ||| | ||||||||||| |
|
|
| T |
12769254 |
atccaaaagtcctagctcaactggtaaaatgccgaaattgttaggtcggatgccatcaccagagttcgaacccc |
12769181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 9640663 - 9640587
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||| |||| || | |||| ||||||||||||| |
|
|
| T |
9640663 |
atccagaagtcatagctcaactggcaaaatgccgatattgttaggccgaatgctataatcgggattcgaaccccggt |
9640587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 369
Target Start/End: Complemental strand, 19836218 - 19836154
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||| ||||||| |||||||| |
|
|
| T |
19836218 |
atattcagaagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgctgtgaccggg |
19836154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 303 - 382
Target Start/End: Complemental strand, 23219253 - 23219173
Alignment:
| Q |
303 |
acatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||||||||||| ||||||||| |||||||| |||||||||||||| ||||||||| | ||||||||||| |||| |
|
|
| T |
23219253 |
acatatgcagaagtcctaactcaactggtaaaatgccaaaattgttaggccgtatgccatgatcggggttcgaacctcggt |
23219173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 380
Target Start/End: Original strand, 32466566 - 32466642
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||| ||||||| |||||| ||||||| ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
32466566 |
atatccagaagtcctagttcaactgataaaatgtcgaaattattaggccggatgctatgaccggagttcgaaccccg |
32466642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 43150283 - 43150211
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
43150283 |
agaagtcctaactcaactggcaaaatggcgaaattgttaggccggatgctatgattggggttcgaaccccggt |
43150211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 307 - 380
Target Start/End: Original strand, 5203549 - 5203624
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||||| |||||||| ||||||| || |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5203549 |
atccagaagtcttagctcaagaggcaaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccg |
5203624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 310 - 365
Target Start/End: Complemental strand, 10070813 - 10070758
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||| |
|
|
| T |
10070813 |
cagaagtcctagctcaactggtaaaatgctgaaattgttaggtcggatgccatgac |
10070758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 299 - 354
Target Start/End: Complemental strand, 37142163 - 37142108
Alignment:
| Q |
299 |
attcacatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccg |
354 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
37142163 |
attcatatatccagaagtcctagcttaactggcaaaatgctgaaattgttaggccg |
37142108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 307 - 358
Target Start/End: Complemental strand, 42337972 - 42337921
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg |
358 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42337972 |
atccagaattcctagctcaactggcaaaatgccgaaattgttaggtcggatg |
42337921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 16371595 - 16371525
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||| ||||| ||||| | |||||||||||||||| |
|
|
| T |
16371595 |
aagtcctagttcaactggcaaaatgccaaaattgttaggctggatgtcatgatcggggttcgaaccccggt |
16371525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 317 - 382
Target Start/End: Complemental strand, 32274095 - 32274029
Alignment:
| Q |
317 |
cctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||| ||||| |||||||| |||||||||||||||| |
|
|
| T |
32274095 |
cctagttcaactggcaaaatgctgaaattgttagggcggataccatgaccggggttcgaaccccggt |
32274029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 1277436 - 1277513
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||| ||| ||||| |||||||||||||||||||||||||||||| ||| |||||||| |||| |
|
|
| T |
1277436 |
atccacaagtcctagctcagctgccaaaaatgccgaaattgttaggccggatgccatgacagggattcgaacctcggt |
1277513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 10011468 - 10011545
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||||||||||||||| || |||||| ||||||||||||| |||||||||||| ||| |||||||| ||||| |
|
|
| T |
10011468 |
tatccaaaagtcctagctcaaccggtaaaatgtcgaaattgttaggtcggatgccatgatcggagttcgaactccggt |
10011545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 10458728 - 10458801
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| ||||| ||| |||||||| ||||||||||||||||||| |||| | |||||||||||||||| |
|
|
| T |
10458728 |
cagaagtcctaactcaattggtaaaatgccaaaattgttaggccggatgctatgatcggggttcgaaccccggt |
10458801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 313 - 381
Target Start/End: Complemental strand, 27004088 - 27004019
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccgg |
381 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| | ||||||||||| | ||||||||| ||||| |
|
|
| T |
27004088 |
aagtcctagctcaactggtaaaatgccgaaattgttagtctggatgccatgatcggggttcgaatcccgg |
27004019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 36185135 - 36185212
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||| | ||| ||||| | |||||||||||||||| |
|
|
| T |
36185135 |
tatccagaaatcctagctcaactggcaaaatgtcgaaattgttaggtcagatatcatgatcggggttcgaaccccggt |
36185212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 36246119 - 36246047
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| |||||||| ||||||| || |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36246119 |
cagaagtcctaactcaactgaaaaaatgc-gacattgttaggccggatgccatgaccggggttcgaaccccggt |
36246047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 25567813 - 25567737
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| ||| |||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
25567813 |
tatccataagtcctagttcaactggcaaaaatgctgaaattattaggccggatgccatgatcggggttcgaaccccg |
25567737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 318 - 369
Target Start/End: Complemental strand, 4430059 - 4430008
Alignment:
| Q |
318 |
ctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
4430059 |
ctagctcaactggtaaaatgtcgaaattgttaggccggatgtcatgaccggg |
4430008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 8487395 - 8487458
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||| ||||||||| || ||||| |||||||||| |
|
|
| T |
8487395 |
tatctagaaatcctagctcaactggcaaaatgccaaaattgttaagctggatgtcatgaccggg |
8487458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 313 - 367
Target Start/End: Complemental strand, 8595611 - 8595556
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg |
367 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| | |||||||| |
|
|
| T |
8595611 |
aagtcctagctcaactggcaaaaatgccgaaattgttaggccggacgtcatgaccg |
8595556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 318 - 380
Target Start/End: Original strand, 41071072 - 41071135
Alignment:
| Q |
318 |
ctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
41071072 |
ctagctcaattggtaaaatgccgaaattgttaggccgggtgccatgatcggagttcgaaccccg |
41071135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 4228854 - 4228932
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||| || |||||||||||||||||||||| |||||||||||| ||| || |||||| | |||||| ||||||||| |
|
|
| T |
4228854 |
atatccataaatcctagctcaactggcaaaatgtcgaaattgttagaccgaataccatgatcggggttccaaccccggt |
4228932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 320 - 381
Target Start/End: Original strand, 5276358 - 5276420
Alignment:
| Q |
320 |
agctcaactggcaaaatg-ccgaaattgttaggccggatgccatgaccgggttcgaaccccgg |
381 |
Q |
| |
|
|||||||||||||||| | ||||||||| || ||||||||||||||||||| ||||||||||| |
|
|
| T |
5276358 |
agctcaactggcaaaaaggccgaaattgctaagccggatgccatgaccggggtcgaaccccgg |
5276420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 311 - 365
Target Start/End: Original strand, 34174323 - 34174377
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
|||||||||||||||||||| |||||| | |||||||||| |||||||||||||| |
|
|
| T |
34174323 |
agaagtcctagctcaactggtaaaatgacaaaattgttagaccggatgccatgac |
34174377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 972720 - 972647
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| ||||||| ||||| || ||||||||||||| ||||||| |||||| |||||||||||||||| |
|
|
| T |
972720 |
agaagtcctagttcaactgacaaaaatgtcgaaattgttaggtcggatgctatgaccagggttcgaaccccggt |
972647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 15067270 - 15067193
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||| ||||||||||| ||| |||| || ||||||||||||||||||||| |||| | |||||||||||||||| |
|
|
| T |
15067270 |
atccagaattcctagctcaattggaaaaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggt |
15067193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 302 - 382
Target Start/End: Original strand, 17080459 - 17080540
Alignment:
| Q |
302 |
cacatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||||||| ||||||||||| | |||||| |||||| ||||||||||| |||| |
|
|
| T |
17080459 |
cacatattcagaagtcgtagctcaactgacaaaatgtcgaaattgttaagtcggatgtcatgacgggggttcgaacctcggt |
17080540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 305 - 362
Target Start/End: Original strand, 19090431 - 19090488
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccat |
362 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| | ||||||||||||| |||||||| |
|
|
| T |
19090431 |
atatccagaagtcttagctcaactggtaaaatgtcaaaattgttaggccagatgccat |
19090488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 28391171 - 28391244
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccc |
378 |
Q |
| |
|
|||||||||||||||||| || | | |||||||||||||||||||| || ||||||||| ||| |||||||||| |
|
|
| T |
28391171 |
tatccagaagtcctagctaaattcgtaaaatgccgaaattgttaggtcgaatgccatgatcggagttcgaaccc |
28391244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 6219315 - 6219247
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccc |
378 |
Q |
| |
|
||||||||||| | |||||| |||| ||||||||||||||| |||||| ||||||||| |||||||||| |
|
|
| T |
6219315 |
agaagtcctagtttaactggtaaaacgccgaaattgttaggtcggatgtcatgaccggtgttcgaaccc |
6219247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 29293651 - 29293575
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||| |||| | || ||||||| ||||||||||||||||||||||||||||| | ||||||||||| |||| |
|
|
| T |
29293651 |
atccaaaagttctagttgaattggcaaagtgccgaaattgttaggccggatgccatgatcggggttcgaacctcggt |
29293575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 40199229 - 40199157
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||| ||||| ||||| || |||||||||||||| |
|
|
| T |
40199229 |
agaaatcctagctcaactgataaaatgccgaaattgttaggctggatgtcatgatcgaagttcgaaccccggt |
40199157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 307 - 377
Target Start/End: Complemental strand, 1931218 - 1931147
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaacc |
377 |
Q |
| |
|
||||| || |||| ||||||||| ||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
1931218 |
atccataaatcctcgctcaactgacaaaatgtcgaaattgttaggccggatgctatgactggggttcgaacc |
1931147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 306 - 364
Target Start/End: Complemental strand, 2706260 - 2706202
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||| ||||| | ||||| |||| |
|
|
| T |
2706260 |
tatccagaagtcctagcttaactggtaaaatgccgaaattattaggtcagatgctatga |
2706202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 322 - 379
Target Start/End: Complemental strand, 20695597 - 20695539
Alignment:
| Q |
322 |
ctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||| ||||||| ||||||||||||| |
|
|
| T |
20695597 |
ctcaactaacaaaatgccgaaattgttaggcccgatgtcatgaccggggttcgaacccc |
20695539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 351
Target Start/End: Original strand, 29069633 - 29069671
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttagg |
351 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29069633 |
aagtcctagctcaactggcaaaataccgaaattgttagg |
29069671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 380
Target Start/End: Complemental strand, 12638596 - 12638523
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccg |
380 |
Q |
| |
|
|||| |||||||||||||||| | ||||| |||||||||||||||||| ||| |||| |||||||||||||| |
|
|
| T |
12638596 |
tccaaaagtcctagctcaactagtaaaatatcgaaattgttaggccggacgccttgacgggggttcgaaccccg |
12638523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 13550379 - 13550303
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc--gggttcgaaccccg |
380 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| || ||| |||||| |||| |||||||| |||||||||||||| |
|
|
| T |
13550379 |
tatccagaaatcctagctcaacgggcaaaatgttgagatttttaggctggataccatgaccgggggttcgaaccccg |
13550303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 380
Target Start/End: Complemental strand, 18692579 - 18692506
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccg |
380 |
Q |
| |
|
|||| |||||||| |||||| ||||||||||| ||||| |||| ||| || ||||||||||| ||||||||||| |
|
|
| T |
18692579 |
tccacaagtcctacctcaaccggcaaaatgccaaaattattagaccgaataccatgaccgggattcgaaccccg |
18692506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 313 - 380
Target Start/End: Complemental strand, 22792234 - 22792165
Alignment:
| Q |
313 |
aagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||| | | |||| |||||||||||||| |
|
|
| T |
22792234 |
aagtcctagctcaactggcaaaaatgccgaaattgttaggtcggacgtcttgacaggggttcgaaccccg |
22792165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 380
Target Start/End: Original strand, 29622237 - 29622278
Alignment:
| Q |
340 |
gaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29622237 |
gaaattgttaggccggatgccatgaccggggttcgaaccccg |
29622278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 306 - 358
Target Start/End: Complemental strand, 7153318 - 7153266
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg |
358 |
Q |
| |
|
|||||| |||||||||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
7153318 |
tatccacaagtcctagctcaactggtaaatagtcgaaattgttaggccggatg |
7153266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 7670365 - 7670441
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||| ||||||||||||||||||||| |||||||||| ||||| ||||| | |||||||||||||||| |
|
|
| T |
7670365 |
atccataagttctagctcaactggcaaaatgctaaaattgttagatcggatatcatgatcggggttcgaaccccggt |
7670441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 13203961 - 13204028
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | | ||| |||||||||||||| |
|
|
| T |
13203961 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcgtgacccgggttcgaaccc |
13204028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 18115092 - 18115168
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
||||| |||| ||| ||||||| |||||||| | ||||||||||||||||| || |||||||| |||||| |||||| |
|
|
| T |
18115092 |
atccaaaagttctaactcaactagcaaaatgtcaaaattgttaggccggataccgtgaccgggattcgaaacccggt |
18115168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 31895640 - 31895565
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||| |||| ||||||| |||| ||||||||||||||||| ||||| |||||| ||||||||||||||| |
|
|
| T |
31895640 |
atccagaagttctagatcaactgccaaa-tgccgaaattgttaggcaggatgtcatgactaaggttcgaaccccggt |
31895565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 317 - 369
Target Start/End: Original strand, 42653550 - 42653602
Alignment:
| Q |
317 |
cctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||| |||||||| ||||||| |||||||||||| ||||||| |||||||||| |
|
|
| T |
42653550 |
cctaactcaactgacaaaatgtcgaaattgttagaccggatgtcatgaccggg |
42653602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 312 - 382
Target Start/End: Complemental strand, 2025805 - 2025734
Alignment:
| Q |
312 |
gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||| |||||||| ||||||| |||||||||||| |||||| ||||| | |||||||||| ||||| |
|
|
| T |
2025805 |
gaagtcctaactcaactgataaaatgcggaaattgttaggtcggatgtcatgatcggggttcgaactccggt |
2025734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 13549281 - 13549206
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccg |
380 |
Q |
| |
|
||||||||| | ||||||||||||||||||| | ||||| ||||||||||| |||||| |||||||||||||| |
|
|
| T |
13549281 |
tatccagaaattatagctcaactggcaaaatgtcaaaatttttaggccggatatcatgacaggggttcgaaccccg |
13549206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 379
Target Start/End: Original strand, 22963693 - 22963760
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
|||| |||||||||||| |||||||| |||||| ||||| ||||| |||||| | ||||||||||||| |
|
|
| T |
22963693 |
aagttctagctcaactgacaaaatgctgaaattattaggtcggataccatgatcagggttcgaacccc |
22963760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 26526517 - 26526588
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||||||| | ||||||||||||||||| | | |||||||| ||||||||| ||||| |
|
|
| T |
26526517 |
aagtcttagctcaactggcaaaaataccgaaattgttaggccgaacgtcatgaccgaggttcgaactccggt |
26526588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 306 - 364
Target Start/End: Original strand, 28489180 - 28489239
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
||||| |||||||||| ||||||| ||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
28489180 |
tatccggaagtcctagttcaactgacaaaaatgccgaaattattaggccggatgctatga |
28489239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 36259821 - 36259872
Alignment:
| Q |
332 |
aaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||| ||||||||| |||||| |
|
|
| T |
36259821 |
aaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggt |
36259872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 311 - 353
Target Start/End: Original strand, 12257360 - 12257401
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggcc |
353 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
12257360 |
agaagtcctagctcaactggc-aaatgccgaaattgtaaggcc |
12257401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 21067439 - 21067485
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||| |||| |
|
|
| T |
21067439 |
cagaagtcctagctcaactggtaaaatatcgaaattgttaggtcgga |
21067485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 24637951 - 24638029
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||||| ||||||||| || |||||| ||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
24637951 |
atatcctgaagttctagctcaattgataaaatgttgaaattgttaggccggatgtcatgattggggttcgaaccccggt |
24638029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 4825063 - 4825019
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
4825063 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga |
4825019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 318 - 382
Target Start/End: Complemental strand, 9362606 - 9362541
Alignment:
| Q |
318 |
ctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| ||| ||||| ||| |||||||||||||| |
|
|
| T |
9362606 |
ctagctcaactggtaaaatgataaaattgttaggccgaatgtcatgatcggagttcgaaccccggt |
9362541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 310 - 351
Target Start/End: Complemental strand, 12819671 - 12819630
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttagg |
351 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||||||||||||| |
|
|
| T |
12819671 |
cagaagtcctaactcaattggtaaaatgccgaaattgttagg |
12819630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 1191664 - 1191597
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| |||||||| | | ||| |||||||||||||| |
|
|
| T |
1191664 |
agaagtcctagctcaactggc-aaatgacgaaattgcaaggccggacgtcgtgatccgggttcgaaccc |
1191597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 356
Target Start/End: Original strand, 8733997 - 8734044
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||| |||||||| |
|
|
| T |
8733997 |
tccagaagtcctagctcaactggc-aaatgctgaaattgcaaggccgga |
8734044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 9577085 - 9577018
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||| ||||| || | ||||||| |||||||||||| |
|
|
| T |
9577085 |
agaagtcctagctcaactggc-aaatgctgaaattgcaaggccagacgtcatgacctgggttcgaaccc |
9577018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 313 - 356
Target Start/End: Original strand, 30527986 - 30528030
Alignment:
| Q |
313 |
aagtcctagctcaactggc-aaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
30527986 |
aagtcctagctcaaccggtgaaaatgccgaaattgttaggccgga |
30528030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 313 - 356
Target Start/End: Original strand, 30568326 - 30568370
Alignment:
| Q |
313 |
aagtcctagctcaactggc-aaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
30568326 |
aagtcctagctcaaccggtgaaaatgccgaaattgttaggccgga |
30568370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 306 - 358
Target Start/End: Complemental strand, 42559959 - 42559907
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg |
358 |
Q |
| |
|
|||||| ||||| |||| ||| || ||||||| |||||||||||||||||||| |
|
|
| T |
42559959 |
tatccacaagtcatagcacaaatgacaaaatgtcgaaattgttaggccggatg |
42559907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 69; Significance: 8e-31; HSPs: 140)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 306 - 385
Target Start/End: Complemental strand, 3848948 - 3848868
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3848948 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgctaggccggatgccatgaccggggttcgaaccccggtgcc |
3848868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 12821164 - 12821240
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12821164 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
12821240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 49882838 - 49882762
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49882838 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggt |
49882762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 304 - 382
Target Start/End: Original strand, 35828270 - 35828349
Alignment:
| Q |
304 |
catatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35828270 |
catattcagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
35828349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 7512765 - 7512842
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7512765 |
tatccagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccccggt |
7512842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 47462166 - 47462089
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47462166 |
tatctagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
47462089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 5397069 - 5396993
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
5397069 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
5396993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 30044713 - 30044637
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
30044713 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt |
30044637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 42154267 - 42154191
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
42154267 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
42154191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 306 - 379
Target Start/End: Original strand, 49535883 - 49535957
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
49535883 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaacccc |
49535957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 9569473 - 9569546
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
9569473 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc |
9569546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 46488247 - 46488170
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| ||||||||| |
|
|
| T |
46488247 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcaaaccccggt |
46488170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 50779921 - 50779844
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50779921 |
tatccagaagtcttagttcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggattcgaaccccggt |
50779844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 1033574 - 1033506
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1033574 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
1033506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 14285094 - 14285170
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14285094 |
atccagaagtcctagctcaactgacaaaatgccaaaattgttaggccggatgccatgaccggcgttcgaaccccggt |
14285170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 24712087 - 24712163
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
24712087 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt |
24712163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 303 - 382
Target Start/End: Complemental strand, 42412121 - 42412041
Alignment:
| Q |
303 |
acatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
42412121 |
acatttccagaagtcatagctcaactggcaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccccggt |
42412041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 380
Target Start/End: Original strand, 37050703 - 37050774
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37050703 |
cagaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccg |
37050774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 42856562 - 42856624
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42856562 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggg |
42856624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 29428053 - 29428130
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
29428053 |
tatccagaagtcctagctcaactggcaaaataccgaaattgttaggccggatgtcatgatcggggttcgaaccccggt |
29428130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 13389019 - 13389095
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
13389019 |
atccagaagtcctagctcaactggcaaaatgctgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt |
13389095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 18813373 - 18813445
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
18813373 |
agaagtcctaactcaactggcaaaatgccgaaattgttaggccggatgtcatgaccgggcttcgaaccccggt |
18813445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 23974771 - 23974699
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
23974771 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatatcatgaccggtgttcgaaccc |
23974699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 24550812 - 24550888
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
24550812 |
atccagaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggt |
24550888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 31263630 - 31263554
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
31263630 |
atccagaagtcctagctcaactggcaaaatgtcgaaattattagaccggatgccatgaccggggttcgaaccccggt |
31263554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 34684202 - 34684277
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
34684202 |
atccagaagtc-tagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
34684277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 54908017 - 54907945
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||| |
|
|
| T |
54908017 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcgaggtttgaaccccggt |
54907945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 1982559 - 1982622
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
1982559 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgtatgtcatgaccggg |
1982622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 306 - 379
Target Start/End: Original strand, 13632087 - 13632162
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg-ggttcgaacccc |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13632087 |
tatccagaagtcctagctcaactggcaaaaatgtcgaaattgttaggccggatgccatgaccgaggttcgaacccc |
13632162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 313 - 379
Target Start/End: Original strand, 28033197 - 28033264
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28033197 |
aagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaacccc |
28033264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 312 - 382
Target Start/End: Original strand, 37166142 - 37166213
Alignment:
| Q |
312 |
gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
37166142 |
gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggt |
37166213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 3084371 - 3084309
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
3084371 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgatcggg |
3084309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 307 - 380
Target Start/End: Original strand, 4379306 - 4379380
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
4379306 |
atccagaagtcctagttcaactgacaaaatgccgaaattgttaggccggatgccatgaccggagttcgaatcccg |
4379380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 24407502 - 24407572
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
24407502 |
aagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgccatgaccgggattcgaaccccggt |
24407572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 319 - 380
Target Start/End: Original strand, 51281477 - 51281539
Alignment:
| Q |
319 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51281477 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggagttcgaaccccg |
51281539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 49319729 - 49319802
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49319729 |
tatccagaagtcctagctcaactaacaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccc |
49319802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 28010180 - 28010104
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||| ||||||| |||||||||||||||| |
|
|
| T |
28010180 |
atccagaagtcctagctcaactggcaaaatgccaaaattgttaggcaggatatcatgaccggggttcgaaccccggt |
28010104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 29648763 - 29648835
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
29648763 |
atccagaagtcctagctcaactagcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaaccc |
29648835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 36526270 - 36526194
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36526270 |
atccagaagtcctagctcaactagcaaaaagccgaaattgttaggccggatgccatgattggggttcgaaccccggt |
36526194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 380
Target Start/End: Complemental strand, 5880412 - 5880341
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
5880412 |
cagaagtcctaactcaactggcaaaatgtcgaaattgttagaccggatgccatgaccggggttcgaaccccg |
5880341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 12694521 - 12694584
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
12694521 |
tatccagaagtcctagctcaactgacaaaatgctgaaactgttaggccggatgccatgaccggg |
12694584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 380
Target Start/End: Complemental strand, 52556509 - 52556438
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
52556509 |
cagaaatcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgatcggggttcgaaccccg |
52556438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 35318539 - 35318601
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35318539 |
atccagaagtcctaactcaactggcaaaatgccgaaattgttaggccggatatcatgaccggg |
35318601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 316 - 381
Target Start/End: Complemental strand, 51564511 - 51564445
Alignment:
| Q |
316 |
tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccgg |
381 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
51564511 |
tcctagctcaactggcaaaatgccgaaactgttaggccggacgccatgaccagggttcgaaccccgg |
51564445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 318 - 382
Target Start/End: Complemental strand, 25586445 - 25586380
Alignment:
| Q |
318 |
ctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
25586445 |
ctagctcaactagcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt |
25586380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 28983730 - 28983807
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||||||| |||||||||||||| |||||||||| ||||| |
|
|
| T |
28983730 |
tatccagaagttctagctcaactggcaaaatgtcgacattgttaggtcggatgccatgaccggggttcgaactccggt |
28983807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 313 - 380
Target Start/End: Original strand, 11673298 - 11673366
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||||||| | |||||||||||||| |
|
|
| T |
11673298 |
aagtcctagctcaactggcaaaataccgaaattgttaggcaggatgccatgatcggggttcgaaccccg |
11673366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 29894409 - 29894481
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||| |||||| ||||||| |||||||||||| |
|
|
| T |
29894409 |
atccagaagtcctagctcaactggcaaaatgtcgaaattattaggtcggatgtcatgaccggggttcgaaccc |
29894481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 31375112 - 31375188
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| |||||||| ||||||| ||||||| ||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
31375112 |
atccagaagtcctaactcaactgccaaaatgtcgaaattattaggccagatgccatgaccggggttcgaaccccggt |
31375188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 1083506 - 1083581
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| | |||| ||||| | |||||||||||||| |
|
|
| T |
1083506 |
tatccagaagtcctagttcaactggcaaaatgccgaaattgttaggtcagatgtcatgatcggggttcgaaccccg |
1083581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 10758016 - 10757945
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||| ||||||||||||| | ||| |||||| |
|
|
| T |
10758016 |
atccagaagtcctacctcaactgccaaaatgccgaaattgttaggtcggatgccatgacggagtttgaaccc |
10757945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 10971187 - 10971116
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccc |
378 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||| ||||||||||||| | ||| |||||| |
|
|
| T |
10971187 |
atccagaagtcctacctcaactgccaaaatgccgaaattgttaggtcggatgccatgacggagtttgaaccc |
10971116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 369
Target Start/End: Complemental strand, 32104136 - 32104077
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32104136 |
cagaagtcttagctaaaatggcaaaatgccgaaattgttaggccggatgccatgaccggg |
32104077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 36752357 - 36752432
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |||| ||||| | |||||||||||||| |
|
|
| T |
36752357 |
tatccagaagtcctaactcaactgacaaaatgccgaaattgttaggccagatgtcatgatcggggttcgaaccccg |
36752432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 316 - 382
Target Start/End: Complemental strand, 39284694 - 39284628
Alignment:
| Q |
316 |
tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
39284694 |
tcctagctcaactggcaaa-tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
39284628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 6487848 - 6487921
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| | ||||| |||||||||||||||| |
|
|
| T |
6487848 |
atccagaagtcctagctcaac---caaaatgccgaaattgttaggccggatgtcgtgaccggggttcgaaccccggt |
6487921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 305 - 378
Target Start/End: Complemental strand, 39301401 - 39301327
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||| |||||||||||||| ||||||| |||||||||||| |
|
|
| T |
39301401 |
atatccagaagtcctagttcaactggcaaactgccgaatttgttaggccggatatcatgaccagggttcgaaccc |
39301327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 26440965 - 26441038
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||| || ||||||| |||||| ||||| |
|
|
| T |
26440965 |
tatccaaaaatcctagctcaactggcaaaatgccgaaattgttaggccgggtgtcatgaccagggttccaaccc |
26441038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 31436048 - 31435971
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||||||||| |||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
31436048 |
tatccacaagtcctagttcaactggtaaaatgccgaaattgttaggccggatgtcatgattggggttcgaaccccggt |
31435971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 310 - 378
Target Start/End: Complemental strand, 33416706 - 33416637
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||| | |||||||||||| |
|
|
| T |
33416706 |
cagaagtcctagctcaactggcaaaataccgaaattgttagaccggatgtcatgatcagggttcgaaccc |
33416637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 42116480 - 42116556
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||| |||||||||||||| |||||| ||||||| ||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
42116480 |
atccagaagccctagctcaactggtaaaatgtcgaaatttttaggtcggatgccatgatcggggttcgaaccccggt |
42116556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 307 - 381
Target Start/End: Original strand, 3037236 - 3037311
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccgg |
381 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||| |||||| ||||| ||||||| |||||||||| |||| |
|
|
| T |
3037236 |
atccagaaatcctagctcaactgtcaaaatgccgaaattattaggctggatgtcatgaccggggttcgaactccgg |
3037311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 12316059 - 12315985
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||| ||||||||||||| |||||| |||||| |||||||| |||||||||||| |||||||||||||| |
|
|
| T |
12316059 |
atccagaagccctagctcaactgaaaaaatgtcgaaatagttaggccagatgccatgaccagggttcgaaccccg |
12315985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 17518602 - 17518540
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| ||||||||| |||||||||||||| |||| |
|
|
| T |
17518602 |
atccagaagtcttagctcaactggtaaaatgccaaaattgttacgccggatgccatgatcggg |
17518540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 376
Target Start/End: Complemental strand, 25699069 - 25698999
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaac |
376 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||| |||||||||||||||||| ||| |||||||| |
|
|
| T |
25699069 |
atccagaagtcctagctcaagaggcaaaatgtcgaaattattaggccggatgccatgatcggagttcgaac |
25698999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 44171648 - 44171710
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||| ||| |||||||| |||||||||| |
|
|
| T |
44171648 |
atccagaagtcctagctcaactagcaaaatgccaaaattattaagccggatgacatgaccggg |
44171710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 310 - 364
Target Start/End: Original strand, 51425332 - 51425386
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51425332 |
cagaagtcctagttcaactagcaaaatgccgaaattgttaggccggatgtcatga |
51425386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 39997903 - 39997826
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||| |||| |||||||||||||| |||||| ||||||||||||||||||| |||||||| ||||||||||| |||| |
|
|
| T |
39997903 |
tatctagaactcctagctcaactgataaaatgtcgaaattgttaggccggataccatgaccggggttcgaacctcggt |
39997826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 579367 - 579295
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
579367 |
agaaatcctagctcaactgataaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggt |
579295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 319 - 378
Target Start/End: Complemental strand, 1053000 - 1052940
Alignment:
| Q |
319 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
1053000 |
tagctcaactgacaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaaccc |
1052940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 18371349 - 18371421
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| || |||||| ||||| |||||||||| |
|
|
| T |
18371349 |
agaagttctagctcaactggcaaaatgccgaaattgttaggccgaatatcatgactggggtttgaaccccggt |
18371421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 366
Target Start/End: Complemental strand, 55853444 - 55853384
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatgacc |
366 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||||| |
|
|
| T |
55853444 |
atccagaagtcctagctcaactggcaaaaatgccaaaattgttaggttggatgccatgacc |
55853384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 308 - 379
Target Start/End: Complemental strand, 17815270 - 17815199
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaacccc |
379 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||| || | | |||||| | ||||||||||| |
|
|
| T |
17815270 |
tccacaagtcctagttcaactggcaaaatgccgaaattgttaggtcgaacgtcatgactgagttcgaacccc |
17815199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 24870601 - 24870672
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| | ||||||| |||||||||| |||| |
|
|
| T |
24870601 |
aagtcctagctcaactggcaaaaatgccgaaattgttaggccggacgtaatgaccgaggttcgaacctcggt |
24870672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 316 - 382
Target Start/End: Original strand, 29334503 - 29334570
Alignment:
| Q |
316 |
tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||| |||||| ||||||||| |||| ||||||||| |
|
|
| T |
29334503 |
tcctagttcaactggcaaaataccgaaattgttaggtcggatgtcatgaccggagttcaaaccccggt |
29334570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 324 - 382
Target Start/End: Complemental strand, 34660903 - 34660844
Alignment:
| Q |
324 |
caactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
34660903 |
caactggcaaaatgcctaaattgttaggtcggatgtcatgaccggggttcgaaccccggt |
34660844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 313 - 378
Target Start/End: Original strand, 46343333 - 46343400
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
46343333 |
aagtcctagctcaactgacaaaagtgccgaaattgttaggccggacgtcatgaccggggttcgaaccc |
46343400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 8810896 - 8810822
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||| ||||||||||||||| ||||| |||||||||| ||||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
8810896 |
cagatgtcctagctcaactgacaaaaatgccgaaattattaggtcggatgtcatgaccggagttcgaaccccggt |
8810822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 310 - 368
Target Start/End: Complemental strand, 9038332 - 9038274
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg |
368 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
9038332 |
cagaagttctagctcaactagcaaaatgccgaaattgtttgaccggatgtcatgaccgg |
9038274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 332 - 382
Target Start/End: Complemental strand, 11311630 - 11311580
Alignment:
| Q |
332 |
aaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
11311630 |
aaaatgccgaaattgttaggccggatgtcatgacggggttcgaactccggt |
11311580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 17271304 - 17271374
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |||||||||| ||||| |||||||||| |
|
|
| T |
17271304 |
aagtcctagctcaacggacaaaatgccgaaattgttaggccaaatgccatgactggggtttgaaccccggt |
17271374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 311 - 369
Target Start/End: Complemental strand, 28187289 - 28187231
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||| |||| |||| |
|
|
| T |
28187289 |
agaagtcctagctcaactgataaaatgtcgaaattgttaggccggatgctatgatcggg |
28187231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 307 - 364
Target Start/End: Complemental strand, 35273436 - 35273378
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
||||| ||||||||||||||||||||||| || |||||||||||||||| ||||||||| |
|
|
| T |
35273436 |
atccacaagtcctagctcaactggcaaaaatgtcgaaattgttaggccgtatgccatga |
35273378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 46194254 - 46194324
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||| |||||| ||||| | |||||||||| ||||| |
|
|
| T |
46194254 |
aagtcctagctcaactggcaaaatgtcaaaattgttaggtcggatgtcatgatcagggttcgaactccggt |
46194324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 316 - 382
Target Start/End: Original strand, 55214484 - 55214550
Alignment:
| Q |
316 |
tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| ||||||||||||||| |||||| |||||| |
|
|
| T |
55214484 |
tcctagctcaactgacaaaatgctaaaattgttaggtcggatgccatgaccgaattcgaatcccggt |
55214550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 9064919 - 9064842
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||| |||||||||||| || ||||||| | | |||||||||||||||| |
|
|
| T |
9064919 |
tatccacaagtcctagctcaactagtaaaatgctgaaattgttaggtcgaatgccataatcggggttcgaaccccggt |
9064842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 9749212 - 9749139
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg-ttcgaaccc |
378 |
Q |
| |
|
||||||||||||||| |||| ||| |||| |||||||||||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
9749212 |
atccagaagtcctagttcaattggtaaaaatgccgaaattgttatgccggatgccatgatcgggattcgaaccc |
9749139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 11371190 - 11371113
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||| ||||||| |||||||| | ||||||||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
11371190 |
tatccagacgtcctagttcaactggaataatgccgaaattgttaggctagataccatgacaggggttcgaaccccggt |
11371113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 17480930 - 17481007
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||| |||| |||||||||||| ||||| |||| |||||||||||||| ||||||||| | |||||||||||||||| |
|
|
| T |
17480930 |
atccacaagttctagctcaactgacaaaaatgccaaaattgttaggccgaatgccatgatcagggttcgaaccccggt |
17481007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 382 - 423
Target Start/End: Complemental strand, 28391019 - 28390978
Alignment:
| Q |
382 |
tgccatctccttggatttcaattgcagcaaaccttgatgatg |
423 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28391019 |
tgccatctccttgaatttcaattgcagcaaaccttgatgatg |
28390978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 379
Target Start/End: Original strand, 54086010 - 54086083
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
||||| ||||||||||||||||| |||||| |||||||||||| | ||||| |||||| | ||||||||||||| |
|
|
| T |
54086010 |
atccaaaagtcctagctcaactgacaaaataccgaaattgttaagtcggataccatgatcggggttcgaacccc |
54086083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 1173955 - 1174022
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
1173955 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacctgggttcgaaccc |
1174022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 305 - 380
Target Start/End: Complemental strand, 5060541 - 5060465
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg |
380 |
Q |
| |
|
|||||||||||||||| |||||||| |||||| |||||||||||| |||||| ||||| ||| |||||||||||| |
|
|
| T |
5060541 |
atatccagaagtcctaactcaactgataaaatgtcgaaattgttagtccggatatcatgatcggcgttcgaaccccg |
5060465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 19225263 - 19225330
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| | |||||| | ||||| |||||||||||||| |
|
|
| T |
19225263 |
agaagtcctagctcaactggc-aaatgccgaaattgtaaagccggacgtcatgatccgggttcgaaccc |
19225330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 21172878 - 21172954
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||| ||||||| |||| |||||||||||||||| |
|
|
| T |
21172878 |
atccagaagtcctggctcaactggtaaaatgccgaaattgttaaaccggatgttatgattggggttcgaaccccggt |
21172954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 34739284 - 34739351
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
34739284 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
34739351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 332 - 380
Target Start/End: Original strand, 43588790 - 43588838
Alignment:
| Q |
332 |
aaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccg |
380 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
43588790 |
aaaatgcggaaattgttaggccggatgtcatgatcgggttcgaaccccg |
43588838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 319 - 382
Target Start/End: Original strand, 47384209 - 47384273
Alignment:
| Q |
319 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| |||||| || ||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
47384209 |
tagctcaactgataaaatgtcggaattgttaggccggatgtcatgaccagggttcgaaccccggt |
47384273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 54768556 - 54768489
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
54768556 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
54768489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 310 - 369
Target Start/End: Original strand, 4901924 - 4901983
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||| |||| |||||| | ||||||||||||||||||| ||||||||| |
|
|
| T |
4901924 |
cagaagtcctagctcgactgataaaatgtcaaaattgttaggccggatgctatgaccggg |
4901983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 382
Target Start/End: Complemental strand, 7944324 - 7944277
Alignment:
| Q |
336 |
tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
7944324 |
tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
7944277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 304 - 382
Target Start/End: Complemental strand, 17846882 - 17846803
Alignment:
| Q |
304 |
catatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
|||||| | |||| |||||||||||||||||||| |||||||||||||| |||| | |||| || |||||||||| |||| |
|
|
| T |
17846882 |
catatctaaaagttctagctcaactggcaaaatgtcgaaattgttaggctggatcctatgatcgaggttcgaacctcggt |
17846803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 21378293 - 21378363
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
21378293 |
tatccagaagtcctagctcaactagc-------cgaaattgttaggccggatgccatgaccggggttcgaactccggt |
21378363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 46552949 - 46553000
Alignment:
| Q |
332 |
aaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
46552949 |
aaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggt |
46553000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 310 - 369
Target Start/End: Original strand, 54864398 - 54864457
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||||| |||||| |||||||| | ||||||||||| |||||||||||| |||| |
|
|
| T |
54864398 |
cagaagtcctagatcaactagcaaaatgtcaaaattgttaggtcggatgccatgatcggg |
54864457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 369
Target Start/End: Complemental strand, 21156084 - 21156022
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| ||||| ||| ||| |||||||| |
|
|
| T |
21156084 |
tccacaagtcctagctcaactggcaaaaatgccgaaattgctaggctggacgccgtgaccggg |
21156022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 380
Target Start/End: Original strand, 33840619 - 33840693
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg |
380 |
Q |
| |
|
|||| |||||||||||||||| |||||| |||||||||| |||||||||| ||||| | | |||||||||||||| |
|
|
| T |
33840619 |
tccacaagtcctagctcaactagcaaaaatgccgaaattattaggccggacgccataatcggggttcgaaccccg |
33840693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 316 - 382
Target Start/End: Original strand, 38882724 - 38882793
Alignment:
| Q |
316 |
tcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| ||| | ||||||||| |||||||||||||| |
|
|
| T |
38882724 |
tcctagctcaactggcaaaaaatgtcgaaattgttaggctggacgtcatgaccggagttcgaaccccggt |
38882793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 48628587 - 48628517
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||| ||| |||| |||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
48628587 |
aagtcctagctcaactggtaaagtgccaaaattgttagattggatgccatgactggggttcgaaccccggt |
48628517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 307 - 379
Target Start/End: Complemental strand, 12619312 - 12619239
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
|||||||||||||| |||||||| |||||| |||||||| ||| |||||||| || || | ||||||||||||| |
|
|
| T |
12619312 |
atccagaagtcctaactcaactgacaaaataccgaaattattaagccggatgtcaagatcagggttcgaacccc |
12619239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 307 - 352
Target Start/End: Complemental strand, 31010074 - 31010029
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggc |
352 |
Q |
| |
|
||||| ||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
31010074 |
atccataagtcttagctcaactggtaaaatgccgaaattgttaggc |
31010029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 51675797 - 51675720
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||| |||||||||||||||| |||||| | ||||||||||||||||| ||||||| |||||||||| ||||| |
|
|
| T |
51675797 |
tatccataagtcctagctcaactaacaaaatatctaaattgttaggccggatatcatgaccggggttcgaactccggt |
51675720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 52303226 - 52303149
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||||| ||| ||||||| |||||||| ||||||||||||| |||||| |||| | ||||||||| |||||| |
|
|
| T |
52303226 |
tatccaaaagtcttagttcaactgacaaaatgctgaaattgttaggctggatgctatgatcggggttcgaatcccggt |
52303149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 238582 - 238515
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| |||| ||| ||||||||| |||||||||||| |
|
|
| T |
238582 |
agaagtcctagctcaactgtc-aaatgccgaaattgcaaggctggacgccatgacctgggttcgaaccc |
238515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 18257333 - 18257396
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcga |
374 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||| |
|
|
| T |
18257333 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgatccgggttcga |
18257396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 19849627 - 19849560
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | | ||| |||||||||||||| |
|
|
| T |
19849627 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcgtgatccgggttcgaaccc |
19849560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 43140030 - 43139963
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
43140030 |
agaagttctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
43139963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 306 - 358
Target Start/End: Original strand, 50501403 - 50501455
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg |
358 |
Q |
| |
|
||||||||| | ||||||||||||||||||| | |||||||||| |||||||| |
|
|
| T |
50501403 |
tatccagaaattctagctcaactggcaaaatactgaaattgttaagccggatg |
50501455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 54097065 - 54096993
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
|||||| ||| ||||| |||||||||||||||||| |||| |||||| |||||||| |||||||||||||| |
|
|
| T |
54097065 |
agaagtactaactcaagtggcaaaatgccgaaattattagatcggatgtcatgaccgacgttcgaaccccggt |
54096993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 322 - 369
Target Start/End: Original strand, 35615899 - 35615946
Alignment:
| Q |
322 |
ctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| |||| |||||||||| |
|
|
| T |
35615899 |
ctcaactgacaaaatgtcgaaattgttaggccagatgtcatgaccggg |
35615946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 306 - 376
Target Start/End: Complemental strand, 53398418 - 53398347
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaac |
376 |
Q |
| |
|
|||||| |||| ||||||||||||||||||| ||||||||||||| | ||| ||||||||| |||||||| |
|
|
| T |
53398418 |
tatccacaagttttagctcaactggcaaaatgttgaaattgttaggctgaatgtcatgaccggagttcgaac |
53398347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 2573927 - 2574005
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaa-ttgttaggccggatgccatgaccggg-ttcgaaccccggt |
382 |
Q |
| |
|
|||| ||||||||||||||||| || |||||| ||||| |||||||| |||||| ||||| |||| ||||||| ||||| |
|
|
| T |
2573927 |
tatctagaagtcctagctcaacaggtaaaatgtcgaaatttgttaggtcggatgtcatgatcgggattcgaactccggt |
2574005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 311 - 369
Target Start/End: Original strand, 8017853 - 8017911
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||| |||||||||||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
8017853 |
agaagtactagctcaactgataaaatgttgaaattgttaggccggatgttatgaccggg |
8017911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 310 - 379
Target Start/End: Original strand, 13218199 - 13218269
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc |
379 |
Q |
| |
|
||||| |||||| | |||||| |||||| | ||||||||||| |||||||||||| | ||||||||||||| |
|
|
| T |
13218199 |
cagaaatcctagtttaactggaaaaatgtcaaaattgttaggtcggatgccatgatcggggttcgaacccc |
13218269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 25726594 - 25726656
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||| ||||||||||| ||| || |||||| |||||||||||||| | ||||||||| |||| |
|
|
| T |
25726594 |
atccacaagtcctagcttaaccggtaaaatgacgaaattgttaggcagaatgccatgatcggg |
25726656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 11277986 - 11278030
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
11277986 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga |
11278030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 316 - 379
Target Start/End: Original strand, 28758384 - 28758449
Alignment:
| Q |
316 |
tcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccgg-gttcgaacccc |
379 |
Q |
| |
|
|||||| ||||||||||||| |||||||||| ||||| |||| | ||||||||| ||||||||||| |
|
|
| T |
28758384 |
tcctagttcaactggcaaaaatgccgaaattattaggtcggacgtcatgaccggagttcgaacccc |
28758449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 319 - 382
Target Start/End: Complemental strand, 36860967 - 36860902
Alignment:
| Q |
319 |
tagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||| |||||| |||||| |||||||||||||||| ||| || |||||||||||||||| |
|
|
| T |
36860967 |
tagctcaactagcaaaaatgccgatattgttaggccggatgtcataactggggttcgaaccccggt |
36860902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 307 - 364
Target Start/End: Original strand, 49870081 - 49870138
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga |
364 |
Q |
| |
|
||||| |||| |||| ||||||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
49870081 |
atccacaagttctagttcaactgacaaaatgctgaaattgttataccggatgccatga |
49870138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 375
Target Start/End: Original strand, 53457828 - 53457892
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaa |
375 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| |||| | ||||| ||||||||||| |
|
|
| T |
53457828 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggtcggacgtcatgacccgggttcgaa |
53457892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 333 - 380
Target Start/End: Complemental strand, 16971785 - 16971737
Alignment:
| Q |
333 |
aaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||| |||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
16971785 |
aaatgcccaaattgttaggccggatgttatgaccggggttcgaaccccg |
16971737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 26424981 - 26424915
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| |||| | ||||| |||||||||||||| |
|
|
| T |
26424981 |
agaagtcctagctcaactggc-aaatgccgaaattgcaagg-cggacgtcatgacccgggttcgaaccc |
26424915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 28798512 - 28798445
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||| |||||||| | | ||| |||||||||||||| |
|
|
| T |
28798512 |
agaagtcctagttcaactggc-aaatgccgaaattgcaaggccggacgtcgtgacccgggttcgaaccc |
28798445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 310 - 357
Target Start/End: Original strand, 32233613 - 32233661
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggat |
357 |
Q |
| |
|
|||||||||||| |||||| |||||| |||||||||||||| ||||||| |
|
|
| T |
32233613 |
cagaagtcctagttcaactcgcaaaaatgccgaaattgttatgccggat |
32233661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 313 - 353
Target Start/End: Complemental strand, 32662725 - 32662685
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggcc |
353 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
32662725 |
aagtcctagctcaactagcaaaatgctaaaattgttaggcc |
32662685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 307 - 351
Target Start/End: Original strand, 34123408 - 34123452
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttagg |
351 |
Q |
| |
|
|||||||||||||||||||| ||| |||||| | ||||||||||| |
|
|
| T |
34123408 |
atccagaagtcctagctcaattggtaaaatgtcaaaattgttagg |
34123452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 313 - 345
Target Start/End: Original strand, 37913318 - 37913350
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaatt |
345 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
37913318 |
aagtcctagctcaactgggaaaatgccgaaatt |
37913350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 38814580 - 38814656
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
|||||| |||||||| ||||| ||| |||| |||| || |||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
38814580 |
tatccacaagtcctaactcaattggtaaaaatgccaaatttgttaggttggatgccatgaccggggttcgaaccccg |
38814656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 369
Target Start/End: Complemental strand, 42550518 - 42550490
Alignment:
| Q |
341 |
aaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42550518 |
aaattgttaggccggatgccatgaccggg |
42550490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 323 - 359
Target Start/End: Complemental strand, 54420274 - 54420238
Alignment:
| Q |
323 |
tcaactggcaaaatgccgaaattgttaggccggatgc |
359 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
54420274 |
tcaactggtaaaatgccgaaattgttatgccggatgc |
54420238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0287 (Bit Score: 66; Significance: 5e-29; HSPs: 1)
Name: scaffold0287
Description:
Target: scaffold0287; HSP #1
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 378
Target Start/End: Complemental strand, 1188 - 1115
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1188 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
1115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0778 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: scaffold0778
Description:
Target: scaffold0778; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 302 - 385
Target Start/End: Original strand, 812 - 896
Alignment:
| Q |
302 |
cacatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc |
385 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
812 |
cacacatctagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcc |
896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 306 - 385
Target Start/End: Complemental strand, 4145 - 4065
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggtgcc |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4145 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaagccggatgccatgactggggttcgaaccccggtgcc |
4065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 39442 - 39366
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39442 |
atccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
39366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 385
Target Start/End: Original strand, 160445 - 160526
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc |
385 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
160445 |
tatccagaagtcctagctcaactggtaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcc |
160526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0595 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: scaffold0595
Description:
Target: scaffold0595; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 344 - 420
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
344 |
atccaaaagtcctagctcaactggcaatatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 8988 - 8912
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
8988 |
atccagaagtcatagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccgaggttcgaaccccggt |
8912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 90567 - 90644
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| | |||||||||||||||| |
|
|
| T |
90567 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggcctgatgtcatgatcggggttcgaaccccggt |
90644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0457 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: scaffold0457
Description:
Target: scaffold0457; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 6782 - 6854
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| ||||| |
|
|
| T |
6782 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaactccggt |
6854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0515 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0515
Description:
Target: scaffold0515; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 2476 - 2553
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| || |||||||| ||||||| ||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
2476 |
tatccagaagtcataactcaactgacaaaatgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggt |
2553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0306 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0306
Description:
Target: scaffold0306; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 2476 - 2553
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||||||||||| || |||||||| ||||||| ||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
2476 |
tatccagaagtcataactcaactgacaaaatgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggt |
2553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 311 - 368
Target Start/End: Complemental strand, 15721 - 15664
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg |
368 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15721 |
agaagtcctagttcaactggcaaaatgccgaaattgttaggtcggatgccatgaccgg |
15664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 311 - 369
Target Start/End: Original strand, 18058 - 18116
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||| |||||||||||||| |||| |
|
|
| T |
18058 |
agaagtcctacctcaactggcaaaataccgaaattgttaagccggatgccatgatcggg |
18116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0163 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: scaffold0163
Description:
Target: scaffold0163; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 305 - 365
Target Start/End: Complemental strand, 27048 - 26988
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac |
365 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27048 |
atatccataagttctagctcaactggcaaaatgcagaaattgttaggccggatgccatgac |
26988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0163; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 369
Target Start/End: Complemental strand, 5595 - 5539
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||| | |||||| ||||| |||| |
|
|
| T |
5595 |
aagttctagctcaactggcagaatgccgaaattgttatgtcggatgtcatgatcggg |
5539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0882 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0882
Description:
Target: scaffold0882; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 312 - 378
Target Start/End: Complemental strand, 3821 - 3754
Alignment:
| Q |
312 |
gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccc |
378 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
3821 |
gaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgctatgactggggttcgaaccc |
3754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0244 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0244
Description:
Target: scaffold0244; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 7886 - 7812
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg |
380 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
7886 |
atccagaagtcttagctcaattggcaaaatgccgaaattgttagatcggatgtcatgaccggggttcgaaccccg |
7812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 312 - 382
Target Start/End: Complemental strand, 93092 - 93021
Alignment:
| Q |
312 |
gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt |
382 |
Q |
| |
|
|||| ||||||||||| || |||||||||||||| |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
93092 |
gaagacctagctcaaccggtaaaatgccgaaattattaggctggatgccatgaccggggttcgaaccccggt |
93021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 306 - 379
Target Start/End: Original strand, 64281 - 64355
Alignment:
| Q |
306 |
tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaacccc |
379 |
Q |
| |
|
|||||| || |||||||||||||| ||||| | ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
64281 |
tatccataaatcctagctcaactgataaaattctgaaattgttaggccggatgccatgaccggagttcgaacccc |
64355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 313 - 363
Target Start/End: Original strand, 95154 - 95204
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatg |
363 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
95154 |
aagttctagttcaactggcaaaatgccgaaattgttaggccggatgccatg |
95204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0242 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0242
Description:
Target: scaffold0242; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 310 - 377
Target Start/End: Original strand, 15060 - 15128
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaacc |
377 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
15060 |
cagaagtcttagctcaactgataaaatgccgaaattgttaggccgaatgtcatgaccgaggttcgaacc |
15128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0242; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 310 - 377
Target Start/End: Original strand, 23895 - 23963
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaacc |
377 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
23895 |
cagaagtcttagctcaactgataaaatgccgaaattgttaggccgaatgtcatgaccgaggttcgaacc |
23963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 114256 - 114323
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
114256 |
agaagtcctagctcaactggc-aaatgccgaaattgtaaggccggacgtcatgatccgggttcgaaccc |
114323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0548 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0548
Description:
Target: scaffold0548; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 6772 - 6822
Alignment:
| Q |
332 |
aaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
6772 |
aaaatgccgaaattgttaggccggatgtcatgacggggttcgaactccggt |
6822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 195739 - 195816
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||||||| |||||| |||||| || ||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
195739 |
atccagaagtcctagttcaactagcaaaaatgtcgaaattgttaggccggatttcatgactggggttcgaaccccggt |
195816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 379
Target Start/End: Original strand, 411647 - 411720
Alignment:
| Q |
307 |
atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc |
379 |
Q |
| |
|
|||| ||||| ||| |||||||||||||||| | ||||||||||| |||||| ||||||| ||||||||||||| |
|
|
| T |
411647 |
atcctgaagttctaactcaactggcaaaatgtcaaaattgttaggtcggatgtcatgaccggggttcgaacccc |
411720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1348 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold1348
Description:
Target: scaffold1348; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 986 - 919
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc |
378 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| | ||||| |||||||||||||| |
|
|
| T |
986 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0633 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0633
Description:
Target: scaffold0633; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 351
Target Start/End: Complemental strand, 3918 - 3880
Alignment:
| Q |
313 |
aagtcctagctcaactggcaaaatgccgaaattgttagg |
351 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3918 |
aagtcctagctcaactggtaaaatgccgaaattgttagg |
3880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0098 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0098
Description:
Target: scaffold0098; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Original strand, 4682 - 4732
Alignment:
| Q |
319 |
tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg |
369 |
Q |
| |
|
||||||||| || |||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
4682 |
tagctcaaccggtaaaatgccaaaattgttaagccggatgccatgaccggg |
4732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 329 - 382
Target Start/End: Original strand, 42073 - 42127
Alignment:
| Q |
329 |
ggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt |
382 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| | |||||||||||||||| |
|
|
| T |
42073 |
ggcaaaatgccaaaattgttaggccggacgccatgatcggggttcgaaccccggt |
42127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0364 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0364
Description:
Target: scaffold0364; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 310 - 367
Target Start/End: Original strand, 11980 - 12037
Alignment:
| Q |
310 |
cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg |
367 |
Q |
| |
|
|||||||| |||||||| ||| |||||| ||||||| |||| |||||||||||||||| |
|
|
| T |
11980 |
cagaagtcgtagctcaattggtaaaatgtcgaaattattagaccggatgccatgaccg |
12037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0067 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0067
Description:
Target: scaffold0067; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 356
Target Start/End: Original strand, 34819 - 34866
Alignment:
| Q |
308 |
tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
34819 |
tccagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga |
34866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0795 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0795
Description:
Target: scaffold0795; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 320 - 358
Target Start/End: Original strand, 1072 - 1110
Alignment:
| Q |
320 |
agctcaactggcaaaatgccgaaattgttaggccggatg |
358 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
1072 |
agctcaactggtaaaatgccgaaattgttaggtcggatg |
1110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 305 - 367
Target Start/End: Original strand, 2158 - 2220
Alignment:
| Q |
305 |
atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg |
367 |
Q |
| |
|
||||||| |||| |||||||||||||| || || |||||||||||| || |||||||||||| |
|
|
| T |
2158 |
atatccacgagtcttagctcaactggcagaacgctgaaattgttaggtcgaatgccatgaccg |
2220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 10097 - 10053
Alignment:
| Q |
311 |
agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga |
356 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
10097 |
agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga |
10053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University