View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_49 (Length: 433)
Name: NF0856_high_49
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_high_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 8e-62; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 8e-62
Query Start/End: Original strand, 222 - 362
Target Start/End: Complemental strand, 11574571 - 11574432
Alignment:
| Q |
222 |
tatccatattatcatcatcatcatataataataagagaacaccaaccaaatgagactgtagcctgtaccttcatggctgatgcacatggtatgcgtcatt |
321 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11574571 |
tatcaatattatcatcatcatcatataataataagagaacaccaaccaaatgagactgtagcctgtaccttcatggctgatgcacatggtatgtgtcatt |
11574472 |
T |
 |
| Q |
322 |
tacctagttggatgtgcaataatgccattttgtattctgat |
362 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
11574471 |
tacct-gttgcatgtgcaataatgccattttgtattctgat |
11574432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 173 - 230
Target Start/End: Complemental strand, 11574789 - 11574732
Alignment:
| Q |
173 |
gatataatttgcatttaacaaatgacatgcatttttcactagattgccttatccatat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11574789 |
gatataatttgcatttaacaaatgacatgcatttttcactagattgccttatccatat |
11574732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 139 - 169
Target Start/End: Complemental strand, 11574908 - 11574878
Alignment:
| Q |
139 |
tgtaatttagccaaatatttatgcagccttt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11574908 |
tgtaatttagccaaatatttatgcagccttt |
11574878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University