View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_50 (Length: 423)
Name: NF0856_high_50
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_high_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 3e-24; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 109 - 174
Target Start/End: Complemental strand, 2313552 - 2313487
Alignment:
| Q |
109 |
tgtagtattcattgtttagagttttatacagttgtttacaagagccttcaaacactaaaatgtgga |
174 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2313552 |
tgtagtattcattatttagagttttatacagttgtttacaagagccttcaaacactataatgtgga |
2313487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 72 - 119
Target Start/End: Complemental strand, 2313648 - 2313601
Alignment:
| Q |
72 |
aagaaaagaaactactaccggttactaagatgtaagttgtagtattca |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2313648 |
aagaaaagaaactactactggttactaagatgtaagttgtagtattca |
2313601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 2313477 - 2313437
Alignment:
| Q |
283 |
tttggccaagccaacgactttaggttgtagattgcttgtgt |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2313477 |
tttggccaagccaacgactttaggttgtagattgcttgtgt |
2313437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3138 times since January 2019
Visitors: 6169