View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_78 (Length: 351)
Name: NF0856_high_78
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_high_78 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 9e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 29 - 151
Target Start/End: Original strand, 47618764 - 47618886
Alignment:
| Q |
29 |
aaaggaaaatggtgcaaatatttgatgacaccataaccttctaccaatttacaaattggagccaaccaaccaaatgtgtttgtttgttcagccccaacaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47618764 |
aaaggaaaatggtgcaaatatttgatgacagcataaccttctaccaatttacaaattggagccaaccaaccaaatgtgtttgtttgttcagccccaacaa |
47618863 |
T |
|
| Q |
129 |
aaaccctcaagaaaatctgcaca |
151 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
47618864 |
aaaccctcaagaaaatctgcaca |
47618886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 209 - 340
Target Start/End: Original strand, 47618945 - 47619076
Alignment:
| Q |
209 |
gcatatatctagaatgagaaccaccctccctctgtacnnnnnnngaaagaaaagcagaacatatttatgatgtatgtatcccacacttgacttcatcatg |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47618945 |
gcatatatctagaatgagaaccaccctccctctgtacaaaaaaagaaagaaaagcagaacatatttatgatgtatgtatcccacacttgacttcatcatg |
47619044 |
T |
|
| Q |
309 |
aatgagattgcattactgaacaagcaacagct |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47619045 |
aatgagattgcattactgaacaagcaacagct |
47619076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2745 times since January 2019
Visitors: 6167