View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0856_high_80 (Length: 349)

Name: NF0856_high_80
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0856_high_80
NF0856_high_80
[»] chr6 (1 HSPs)
chr6 (151-336)||(20914672-20914858)
[»] chr5 (1 HSPs)
chr5 (215-333)||(6699086-6699203)
[»] chr7 (2 HSPs)
chr7 (62-120)||(16673169-16673227)
chr7 (62-120)||(17647537-17647595)


Alignment Details
Target: chr6 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 151 - 336
Target Start/End: Complemental strand, 20914858 - 20914672
Alignment:
151 gctggttgtgcgtgtggctgctacctggttaggcagcagattactgctatagctttggttactgcagagttgttt-gtttgtgcgcaactgttgggggtt 249  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||    
20914858 gctggttgtgcgtgtggctgctacctggttaggcagcagattactgctatagctttggatgctgcagagttgttttgtttgtgcgcaactgttgggggtt 20914759  T
250 ctagagctgcagaattcgtggttgctggtgtgctttttgggggagtagctactgtgttctttttaactggtttttcggtttgttcct 336  Q
    | ||||||||| ||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||    
20914758 ccagagctgcaaaattcgtggttgctggtgtgctttttgggggagcagctgctgtgttctttttaactggtttttcggtttgttcct 20914672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 215 - 333
Target Start/End: Original strand, 6699086 - 6699203
Alignment:
215 cagagttgtttgtttgtgcgcaactgttgggggttctagagctgcagaattcgtggttgctggtgtgctttttgggggagtagctactgtgttcttttta 314  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |||||| |||| ||||||||||||||    
6699086 cagagttgtttgtttgtgcgcaactgttgggggttctagagctgcagaattcgtggctgctggtgtgcctttt-ggggagcagctgctgtgttcttttta 6699184  T
315 actggtttttcggtttgtt 333  Q
    |||||||||||||||||||    
6699185 actggtttttcggtttgtt 6699203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 120
Target Start/End: Original strand, 16673169 - 16673227
Alignment:
62 ttctgattttttgtagggtgttgtcatgttaccaaacatgtttgccaatgatttcagag 120  Q
    ||||| ||| || ||||||||||||| ||||||||||||||||||   |||||||||||    
16673169 ttctgttttattttagggtgttgtcaagttaccaaacatgtttgcagctgatttcagag 16673227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 120
Target Start/End: Original strand, 17647537 - 17647595
Alignment:
62 ttctgattttttgtagggtgttgtcatgttaccaaacatgtttgccaatgatttcagag 120  Q
    ||||| ||| || ||||||||||||| ||||||||||||||||||   |||||||||||    
17647537 ttctgttttattttagggtgttgtcaagttaccaaacatgtttgcagctgatttcagag 17647595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3653 times since January 2019
Visitors: 6174