View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_94 (Length: 332)
Name: NF0856_high_94
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_high_94 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 12 - 303
Target Start/End: Original strand, 45103536 - 45103826
Alignment:
Q |
12 |
acagaacagaacacattttcttctgatggagcaaacatgggaaaattggcctcttcattcggtaataacactagctacacatataattatttctcataag |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45103536 |
acagaacagaacacattttcttctgatggagcaaacatgggaaaattggcctcttcattcggtaataacactagctacacatataattatttctcataag |
45103635 |
T |
 |
Q |
112 |
ttatactttatgnnnnnnnataaatcgtaaatcattatgatcaacnnnnnnnnnnntgttatgtatcatttatattttctcataaaccttgttttaactt |
211 |
Q |
|
|
|||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45103636 |
ttatactttatgtttttttataaatcctaaatcattatgatcaacaaaaaaaaaa-tgttatgtatcatttatattttctcataaaccttgttttaactt |
45103734 |
T |
 |
Q |
212 |
tttaactaactgtcattattacaataggaaatggttgatgtagagaatatgcaagggcaatattgtcatcaaacaagtactgatgatgaaga |
303 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45103735 |
tttaactaactgtcattattacaataggaaatggttgatgtagagaatatgcaagggcaatattgtcatcaaacaagtactgatgatgaaga |
45103826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 232 - 303
Target Start/End: Original strand, 45130384 - 45130455
Alignment:
Q |
232 |
acaataggaaatggttgatgtagagaatatgcaagggcaatattgtcatcaaacaagtactgatgatgaaga |
303 |
Q |
|
|
|||||||||| ||| |||||||||| | ||| ||||||||||||||||||||| ||| ||||||||||||| |
|
|
T |
45130384 |
acaataggaattgggtgatgtagaggttttgctagggcaatattgtcatcaaactagtgctgatgatgaaga |
45130455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3800 times since January 2019
Visitors: 6175