View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_96 (Length: 331)
Name: NF0856_high_96
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_high_96 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 274; Significance: 1e-153; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 14 - 303
Target Start/End: Complemental strand, 12347269 - 12346980
Alignment:
| Q |
14 |
gagaaaagacaacaattgttcaactgttgctgaacatgagttaacttcaatggtaggggaagacctagaaactgtacaagatttggtgaaaattcatcgc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12347269 |
gagaaaagacaacaattgttcaactgttgctgatcatgagttaacttcaatggtaggggaagacctggaaactgtacaagatttggtgaaaattcatcgc |
12347170 |
T |
|
| Q |
114 |
caatttatgccacataatcgatgtccagcgtgagccagtatgcttgtaattgtaaactcctcgtgacttctaaatttgatcagaatcatatggttaaagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12347169 |
caatttatgccacataatcgatgtccagcgtgagccagtatgcttgtaattgtaaagtcctcgtgacttctaaatttgatcagaatcatatggttaaagg |
12347070 |
T |
|
| Q |
214 |
caacttaacttaatcatgagttgttttatcttgccacttttcattccttgcttgattggtttatccagatattcttttttaggtataatt |
303 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12347069 |
cgacttaacttaatcatgagttgttttatcttgccacttttcattccttgcttgattggtttatccagatattcttttttaggtataatt |
12346980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 14 - 162
Target Start/End: Complemental strand, 12338762 - 12338613
Alignment:
| Q |
14 |
gagaaaagacaacaattgttcaactgttgctgaacatgagttaacttcaatggtaggggaagacctagaaactgtacaagatttggtgaaaattcatcgc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12338762 |
gagaaaagacaacaattgttcaactgttgcggaacttgagttaacttcaatggtaggagaagacctagaaactgtaaaagatttggtgaaaattcatcgc |
12338663 |
T |
|
| Q |
114 |
caatttatgccacataatcgatgtccagcgtgag-ccagtatgcttgtaa |
162 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
12338662 |
caatttatgccacataatcgatgtccagtgtgagaacagtatgcttgtaa |
12338613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3718 times since January 2019
Visitors: 6175