View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_high_97 (Length: 330)
Name: NF0856_high_97
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_high_97 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 12 - 301
Target Start/End: Original strand, 45103536 - 45103826
Alignment:
| Q |
12 |
acagaacagaacacattttcttctgatggagcaaacatgggaaaattggcctcttcattcggtaataacactagctacacatataattatttctcataag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103536 |
acagaacagaacacattttcttctgatggagcaaacatgggaaaattggcctcttcattcggtaataacactagctacacatataattatttctcataag |
45103635 |
T |
|
| Q |
112 |
ttatactttatgnnnnnnnataaatcgtaaatcattatgatcaacnnnnnnnnn-tgttatgtatcatttatattttctcataaaccttgttttaacttt |
210 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103636 |
ttatactttatgtttttttataaatcctaaatcattatgatcaacaaaaaaaaaatgttatgtatcatttatattttctcataaaccttgttttaacttt |
45103735 |
T |
|
| Q |
211 |
ttaactaactgtcattattacaataggaaatggttgatgtagagaatatgcaagggcaatattgtcatcaaacaagtactgatgatgaaga |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103736 |
ttaactaactgtcattattacaataggaaatggttgatgtagagaatatgcaagggcaatattgtcatcaaacaagtactgatgatgaaga |
45103826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 230 - 301
Target Start/End: Original strand, 45130384 - 45130455
Alignment:
| Q |
230 |
acaataggaaatggttgatgtagagaatatgcaagggcaatattgtcatcaaacaagtactgatgatgaaga |
301 |
Q |
| |
|
|||||||||| ||| |||||||||| | ||| ||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
45130384 |
acaataggaattgggtgatgtagaggttttgctagggcaatattgtcatcaaactagtgctgatgatgaaga |
45130455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2212 times since January 2019
Visitors: 6159