View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_10 (Length: 697)
Name: NF0856_low_10
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 2e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 30 - 169
Target Start/End: Complemental strand, 41181374 - 41181235
Alignment:
| Q |
30 |
acaacgatgctggcactaattgctatgatgttgaatattattatgatcaaggaggagatgttgggtattctcttcaatttggaggacctggtggttattg |
129 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||| ||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41181374 |
acaacgatgctggcactgtttgctatggtgttgaatattatggtgatcaaagtggaaatgttgggtattctcttcaatttggaggacctggtggttattg |
41181275 |
T |
 |
| Q |
130 |
tgagaattattaattttagtgaacttcatttgtttattac |
169 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41181274 |
tgagaattattaattttagtgaacatcatttgtttattac |
41181235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University