View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_104 (Length: 343)
Name: NF0856_low_104
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_104 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 102 - 264
Target Start/End: Complemental strand, 11401646 - 11401484
Alignment:
| Q |
102 |
cttacaagtaaagataaaacaaacggtgctccttatcttcaagtggtccagtagtatcatcatttcttaatggtgaagacttgtcttctagaatgcttct |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11401646 |
cttacaagtaaagataaaacaaacggtgctccttatcttcaagtggtccagtagtatcatcatttcttaatggtgaagacttgtcttctggaatgcttct |
11401547 |
T |
|
| Q |
202 |
aaaatcttctagtttatgcttgatttaattttcttacagttgtcatttgtcattgttgatatt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
11401546 |
aaaatcttctagtttatgcttgatttaattttcttacggttgtcatttgtcattgtttatatt |
11401484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3339 times since January 2019
Visitors: 6172