View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_121 (Length: 316)
Name: NF0856_low_121
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_121 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 13 - 316
Target Start/End: Original strand, 27640305 - 27640608
Alignment:
| Q |
13 |
gagaagctgttttgggagatgccgcataggaatgtggtgtcgtggactgttatgattggtgggttgttgaaggaatcgcgtattgatgatgcgaagaaac |
112 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27640305 |
gagaagctgttttgggagatgccacgtaggaatgtggtgtcgtggactgttatgattggtgggttgttgaaggaatcgcgtattgatgatgcgaagaaac |
27640404 |
T |
 |
| Q |
113 |
tgtttgatatgataccggagaaggatgttgtggtggttactaatatgattggtgggtattgtcaggtgggtcgtttggatgaagctcgcgaactgtttga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27640405 |
tgtttgatatgataccggagaaggatgttgtggtggttactaatatgattggtgggtattgtcaggtgggtcgtttggatgaagctcgcgaactgtttga |
27640504 |
T |
 |
| Q |
213 |
tgaaatgaaggtgaggaatgtgtttacttggactactatggtttctgggtatgcaaagaatgggagggttgatgttgcaaggaagctttttgaggtgatg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27640505 |
tgaaatgaaggtgaggaatgtgtttacttggactactatggtttctgggtatgcaaagaatgggagggttgatgttgcaaggaagctttttgaggtgatg |
27640604 |
T |
 |
| Q |
313 |
ccgg |
316 |
Q |
| |
|
|||| |
|
|
| T |
27640605 |
ccgg |
27640608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 269
Target Start/End: Complemental strand, 1032073 - 1032039
Alignment:
| Q |
235 |
tttacttggactactatggtttctgggtatgcaaa |
269 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1032073 |
tttacttggactactatggttgctgggtatgcaaa |
1032039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University