View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0856_low_124 (Length: 313)

Name: NF0856_low_124
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0856_low_124
NF0856_low_124
[»] chr3 (3 HSPs)
chr3 (102-242)||(11574432-11574571)
chr3 (53-110)||(11574732-11574789)
chr3 (1-49)||(11574878-11574926)


Alignment Details
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 102 - 242
Target Start/End: Complemental strand, 11574571 - 11574432
Alignment:
102 tatccatattatcatcatcatcatataataataagagaacaccaaccaaatgagactgtagcctgtaccttcatggctgatgcacatggtatgcgtcatt 201  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
11574571 tatcaatattatcatcatcatcatataataataagagaacaccaaccaaatgagactgtagcctgtaccttcatggctgatgcacatggtatgtgtcatt 11574472  T
202 tacctagttggatgtgcaataatgccattttgtattctgat 242  Q
    ||||| |||| ||||||||||||||||||||||||||||||    
11574471 tacct-gttgcatgtgcaataatgccattttgtattctgat 11574432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 11574789 - 11574732
Alignment:
53 gatataatttgcatttaacaaatgacatgcatttttcactagattgccttatccatat 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11574789 gatataatttgcatttaacaaatgacatgcatttttcactagattgccttatccatat 11574732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 11574926 - 11574878
Alignment:
1 aattaaacaaagggaaagtataatctagccaaatatttatgcagccttt 49  Q
    |||||||||||| |||||| |||| ||||||||||||||||||||||||    
11574926 aattaaacaaagagaaagtgtaatttagccaaatatttatgcagccttt 11574878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University