View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_124 (Length: 313)
Name: NF0856_low_124
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_124 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 102 - 242
Target Start/End: Complemental strand, 11574571 - 11574432
Alignment:
| Q |
102 |
tatccatattatcatcatcatcatataataataagagaacaccaaccaaatgagactgtagcctgtaccttcatggctgatgcacatggtatgcgtcatt |
201 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11574571 |
tatcaatattatcatcatcatcatataataataagagaacaccaaccaaatgagactgtagcctgtaccttcatggctgatgcacatggtatgtgtcatt |
11574472 |
T |
|
| Q |
202 |
tacctagttggatgtgcaataatgccattttgtattctgat |
242 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
11574471 |
tacct-gttgcatgtgcaataatgccattttgtattctgat |
11574432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 11574789 - 11574732
Alignment:
| Q |
53 |
gatataatttgcatttaacaaatgacatgcatttttcactagattgccttatccatat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11574789 |
gatataatttgcatttaacaaatgacatgcatttttcactagattgccttatccatat |
11574732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 11574926 - 11574878
Alignment:
| Q |
1 |
aattaaacaaagggaaagtataatctagccaaatatttatgcagccttt |
49 |
Q |
| |
|
|||||||||||| |||||| |||| |||||||||||||||||||||||| |
|
|
| T |
11574926 |
aattaaacaaagagaaagtgtaatttagccaaatatttatgcagccttt |
11574878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3159 times since January 2019
Visitors: 6171