View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_135 (Length: 298)
Name: NF0856_low_135
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_135 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 9 - 59
Target Start/End: Complemental strand, 2744288 - 2744238
Alignment:
Q |
9 |
tcaatgataatgccaccaaaccctgtcatatagaaatttattaattctcat |
59 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2744288 |
tcaatgataatgccaccaaaccctgtcatatagaaatttattaattctcat |
2744238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 82 - 124
Target Start/End: Complemental strand, 2744241 - 2744199
Alignment:
Q |
82 |
tcataatatatgtttatctcaatattttgtagaattgaataac |
124 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2744241 |
tcataatatatgtttatctcaatattttgtagaattgaataac |
2744199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3147 times since January 2019
Visitors: 6169