View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_152 (Length: 284)
Name: NF0856_low_152
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_152 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 45103703 - 45103949
Alignment:
| Q |
1 |
tttatattttctcataaaccttgttttaactttttaactaactgtcattattacaataggaaatggttgatgtagagaatatgcaagggcaatattgtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103703 |
tttatattttctcataaaccttgttttaactttttaactaactgtcattattacaataggaaatggttgatgtagagaatatgcaagggcaatattgtca |
45103802 |
T |
 |
| Q |
101 |
tcaaacaagtactgatgatgaagaagagttcttgagagacataattcttcagcaacctgttgcatattctggaagcagtttatcatcttctagtgagatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103803 |
tcaaacaagtactgatgatgaagaagagttcttgagagacataattcttcagcaacctgttacatattctggaagcagtttatcatcttctagtgagatg |
45103902 |
T |
 |
| Q |
201 |
gacggttcagatagctcggggaaaaagcttcatccttcatcatcacc |
247 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| || |||| |||| |
|
|
| T |
45103903 |
gacggttcagatagctcggggaaaaaacttcatcttttatcaacacc |
45103949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 53 - 255
Target Start/End: Original strand, 45130384 - 45130583
Alignment:
| Q |
53 |
acaataggaaatggttgatgtagagaatatgcaagggcaatattgtcatcaaacaagtactgatgatgaagaagagttcttgagagacataattcttcag |
152 |
Q |
| |
|
|||||||||| ||| |||||||||| | ||| ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45130384 |
acaataggaattgggtgatgtagaggttttgctagggcaatattgtcatcaaactagtgctgatgatgaagaagagttcttgagagacataatccttcag |
45130483 |
T |
 |
| Q |
153 |
caacctgttgcatattctggaagcagtttatcatcttctagtgagatggacggttcagatagctcggggaaaaagcttcatccttcatcatcaccgttca |
252 |
Q |
| |
|
||||||||| ||||||||||| ||| ||||||| |||| ||||||||| || |||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45130484 |
caacctgttacatattctgga---agtatatcatcctctaatgagatggatggctcagattgctcaaagaaaaagcttcatccttcatcatcaccgttca |
45130580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University