View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_153 (Length: 280)
Name: NF0856_low_153
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_153 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 12103584 - 12103305
Alignment:
Q |
1 |
gtcctttcatcttccatgtagctgctacaaggacttcctcatctccatctcgacagagtgcgcttaatccctaggagttcgcttcagacaggtttgcatc |
100 |
Q |
|
|
|||||||||||||||||||||| ||| ||| ||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
12103584 |
gtcctttcatcttccatgtagccgctgcaatgacttccccatctccatctcgacagagtgcgcttaatccccaggagttcgcttcagacaggtttgcatc |
12103485 |
T |
 |
Q |
101 |
agtgttcattttgtacaaattattttctggtttcctccatcttgtctgaactgtatgctgagtttgctgattgtgcgtagaagtcgagttctgcatcatg |
200 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | || ||||||||| |
|
|
T |
12103484 |
agtgttcattttgtacaaattattttatggtttcctccatcttgtcggaactgtatgctgagtttgctgattgtgcgtagaagtcaatttatgcatcatg |
12103385 |
T |
 |
Q |
201 |
ttgagtatgttgttgattttattgcatatttggtactcgtgaattgttttgttgatgtggtttagaatgtcttctatgtt |
280 |
Q |
|
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
12103384 |
ttgggtatgttgttgattttattgcatatttggtactcgtgaattgttttgttgatgtagtttagaatgtcttctatgtt |
12103305 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University