View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_154 (Length: 279)
Name: NF0856_low_154
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_154 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 43 - 279
Target Start/End: Complemental strand, 33817522 - 33817286
Alignment:
| Q |
43 |
aacctgtgcatatctagtgaaaaggtttatcagtgaatttatgcaagatgccttcccattgcgaaatatcattatgtgatctgcatacaaagtatgaaat |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33817522 |
aacctgtgcatatctagtgaaaaggtttatcagtgaatttatgcaagatgccttcccattgctaaatatcattatgtgatctgcatacaaagtatgaaat |
33817423 |
T |
|
| Q |
143 |
ggaacatcacagcttctagtgcttgacatcaactctaaatcaccattatccaccggtttagaaatgcccctgctcaacacttcttctgcaagatagaaaa |
242 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33817422 |
ggaacatcacaacttctagtgcttgacatcaactctaaatcaccattatccaccagtttagaaatgcccgtgctcaacacttcttctgcaagatagaaaa |
33817323 |
T |
|
| Q |
243 |
gcgagtacacttaaagtacacttaaaagtaaccatgt |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33817322 |
gcgagtacacttaaagtacacttaaaagtaaccatgt |
33817286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2468 times since January 2019
Visitors: 6164