View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_155 (Length: 278)
Name: NF0856_low_155
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_155 |
 |  |
|
[»] chr3 (4 HSPs) |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 4e-75; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 136 - 278
Target Start/End: Complemental strand, 48527288 - 48527146
Alignment:
Q |
136 |
tctaacatattttaatcatgaaagatacattaaatgaataatttgggttaatgtgcataattttattgaattgaatgtaggtggacctatctgggggata |
235 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48527288 |
tctaacatattttaatcatgaaagatacattaaatgaataatttgggttaatgtgcataattttattgaattgaatgtaggtggacctatctgggggata |
48527189 |
T |
 |
Q |
236 |
ttatgatgcaggagataatgtgaaatatgggctaccaatggca |
278 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48527188 |
ttatgatgcaggagataatgtgaaatatgggctaccaatggca |
48527146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 16 - 133
Target Start/End: Complemental strand, 48527547 - 48527430
Alignment:
Q |
16 |
atcccttatattcttagaggcacaaagatcaggaaaactccctccaaataacagggttccttggagaggagactcagctgtcgacgacggcaaactcgct |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48527547 |
atcccttatattcttagaggcacaaagatcaggaaaactccctccaaataacagggttccttggagaggagactcagctgtcgacgacggcaaactcgct |
48527448 |
T |
 |
Q |
116 |
aatgtatctttctttttc |
133 |
Q |
|
|
||||||||||| |||||| |
|
|
T |
48527447 |
aatgtatctttatttttc |
48527430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 26 - 133
Target Start/End: Complemental strand, 7222847 - 7222740
Alignment:
Q |
26 |
ttcttagaggcacaaagatcaggaaaactccctccaaataacagggttccttggagaggagactcagctgtcgacgacggcaaactcgctaatgtatctt |
125 |
Q |
|
|
||||||||||| ||||||||||| ||||||||||| | ||| ||||| |||||||||||||||||||| || || || || ||||||| |||||||| || |
|
|
T |
7222847 |
ttcttagaggcgcaaagatcagggaaactccctcccagtaatagggtcccttggagaggagactcagcagtggatgatggaaaactcgataatgtatgtt |
7222748 |
T |
 |
Q |
126 |
tctttttc |
133 |
Q |
|
|
|||||||| |
|
|
T |
7222747 |
tctttttc |
7222740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 195 - 278
Target Start/End: Complemental strand, 7222612 - 7222531
Alignment:
Q |
195 |
attttattgaattgaatgtaggtggacctatctgggggatattatgatgcaggagataatgtgaaatatgggctaccaatggca |
278 |
Q |
|
|
||||||||||||||||| |||| |||||||| || |||||||||||||| || || ||||||||||||||||||||||||||| |
|
|
T |
7222612 |
attttattgaattgaat--aggttgacctatcaggaggatattatgatgccggggacaatgtgaaatatgggctaccaatggca |
7222531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 237 - 278
Target Start/End: Original strand, 41915316 - 41915357
Alignment:
Q |
237 |
tatgatgcaggagataatgtgaaatatgggctaccaatggca |
278 |
Q |
|
|
||||||||||| ||||||||||||| |||| ||||||||||| |
|
|
T |
41915316 |
tatgatgcaggggataatgtgaaatttgggttaccaatggca |
41915357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2643 times since January 2019
Visitors: 6164