View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_161 (Length: 272)
Name: NF0856_low_161
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_161 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 11401722 - 11401484
Alignment:
Q |
1 |
aatgaagagacggttcagatattttaataaagatagtcttgcatgtaagcaagatacatgcttgatggctaagtttcttacaagtaaagataaaacaaac |
100 |
Q |
|
|
||||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11401722 |
aatgaagaggcgtttcagataatttaataaagatagtcttgcatgtaagcaagatacatgcttgatggctaagtttcttacaagtaaagataaaacaaac |
11401623 |
T |
 |
Q |
101 |
ggtgctccttatcttcaagtggtccagtagtatcatcatttcttaatggtgaagacttgtcttctagaatgcttctaaaatcttctagtttatgcttgat |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
11401622 |
ggtgctccttatcttcaagtggtccagtagtatcatcatttcttaatggtgaagacttgtcttctggaatgcttctaaaatcttctagtttatgcttgat |
11401523 |
T |
 |
Q |
201 |
ttaattttcttacagttgtcatttgtcattgttgatatt |
239 |
Q |
|
|
||||||||||||| ||||||||||||||||||| ||||| |
|
|
T |
11401522 |
ttaattttcttacggttgtcatttgtcattgtttatatt |
11401484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University