View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_170 (Length: 268)
Name: NF0856_low_170
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_170 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 77 - 242
Target Start/End: Original strand, 46568463 - 46568628
Alignment:
Q |
77 |
tatcaagtggtggacacattggccttgtgtctagaaatgcaatttcacgaaactatcttcaacgttctttttccaaaaaattaagcgtcattcacaattt |
176 |
Q |
|
|
||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46568463 |
tatcaagtgatggacacattggcattgtatctagaaatgcaatttcacgaaactatcttcaacgttctttttccaaaaaattaagcgtcattcacaattt |
46568562 |
T |
 |
Q |
177 |
taacactacattaatttcagcaatgagtgctccaaactctgattccttatttcattctcttcatct |
242 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
46568563 |
taacactacattaatttcagcaatgagtcctccaaactctgattccttatttcattctcttcatct |
46568628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 47 - 80
Target Start/End: Original strand, 46568394 - 46568427
Alignment:
Q |
47 |
ttattacccttcttgggtgctcttcaattttatc |
80 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
46568394 |
ttattacccttcttgggtgctcttcaattttatc |
46568427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2718 times since January 2019
Visitors: 6167