View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_175 (Length: 266)
Name: NF0856_low_175
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_175 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 97 - 266
Target Start/End: Complemental strand, 33817455 - 33817286
Alignment:
| Q |
97 |
atcatcatgtgatctgcatacaaagtatgaaatggaacatcacagcttctagtgcttgacatcaactctaaatcaccattatccaccggtttagaaatgc |
196 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33817455 |
atcattatgtgatctgcatacaaagtatgaaatggaacatcacaacttctagtgcttgacatcaactctaaatcaccattatccaccagtttagaaatgc |
33817356 |
T |
|
| Q |
197 |
ccctgctcaacacttcttctgcaagatagaaaagcgagtacacttaaagtacacttaaaagtaaccatgt |
266 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33817355 |
ccgtgctcaacacttcttctgcaagatagaaaagcgagtacacttaaagtacacttaaaagtaaccatgt |
33817286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2650 times since January 2019
Visitors: 6164