View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0856_low_189 (Length: 254)

Name: NF0856_low_189
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0856_low_189
NF0856_low_189
[»] chr7 (1 HSPs)
chr7 (1-135)||(27640638-27640772)


Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 27640638 - 27640772
Alignment:
1 cttatggggtatactcagagtcggaggatgaaggaggcttttgagctttttgaagcgatgccggtgaagtggtttgttgcttgtaatgagatgatcttac 100  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
27640638 cttatggggtatactcagagtgggaggatgaaggaggcttttgagctttttgaagcgatgccggtgaagtggattgttgcttgtaatgagatgatcttac 27640737  T
101 agtttggacttgctggggagatgcatagagctagg 135  Q
    |||||||||||||||||||||||||||||||||||    
27640738 agtttggacttgctggggagatgcatagagctagg 27640772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University