View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_194 (Length: 251)
Name: NF0856_low_194
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_194 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 251
Target Start/End: Complemental strand, 10107590 - 10107352
Alignment:
Q |
13 |
attctcatatcaaattcaaaaaagactttagtttgacaaatggagttcgatctagcagaagtagctagattctcatgacataacgatctaaaatttaaat |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10107590 |
attctcatatcaaattcaaaaaagactttagtttgacaaatgaagttcgatctagcagaagtagctagattctcatgacataacgatctaaaatttaaat |
10107491 |
T |
 |
Q |
113 |
ttcgacacggaaaaatgtctaagatcaactttagtatgcataattttgatgtgtagtttggaaatgagagtattttgccaaatttccattggagttagac |
212 |
Q |
|
|
|| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |||||||||| ||| |
|
|
T |
10107490 |
tttgacacggaaaaatgtttaagatcaactttagtatgcataattttggtgtgtagtttgaaaatgagagtattttgccaaattttcattggagttggac |
10107391 |
T |
 |
Q |
213 |
aacttgcaataaccatgtttttcgaaagcaacctaacct |
251 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
T |
10107390 |
aacttgcaataaccgtgtttttcgaaagcaacctaacct |
10107352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University