View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_196 (Length: 251)
Name: NF0856_low_196
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_196 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 45166664 - 45166902
Alignment:
| Q |
1 |
aactatggggaaacaacaagaacgggttagaaaacaaaggaatattatccacactttgctttttcaagtatcggcagaatttcttgaggttcacgatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45166664 |
aactatggggaaacaacaagaacgggttagaaaacaaaggaatattatccacactttgctttttcaagtatcggcagaatttcttgaggttcacgatttg |
45166763 |
T |
 |
| Q |
101 |
gaatgtttgacttactgtagtttagtttccatggatgcaaacaaacataggatgggaaattcctccgaaaaccttgtcaagtgtctcatgttttatatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45166764 |
gaatgtttgacttactgtagtttagtttccatggatgcaaacaaacataggatgggaaattcctccgaaaaccttgtcaagtgtctcatgttttatatgg |
45166863 |
T |
 |
| Q |
201 |
tcattaacttcaaggaaatttagtcacctcccaaagtat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45166864 |
tcattaacttcaaggaaatttagtcacctcccaaagtat |
45166902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University