View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_199 (Length: 251)
Name: NF0856_low_199
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_199 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 29 - 251
Target Start/End: Complemental strand, 33295525 - 33295302
Alignment:
| Q |
29 |
aaatggtccccagccaagccacatctacttgttttgatttgttatttgactaagatctttgcagactagttatgcactaaaataatgtgacattctctct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33295525 |
aaatggtccccagccaagccacatctacttgttttgatttgttatttgactaagatctttgcagactagttatgcactaaaataatgtgacattctctct |
33295426 |
T |
|
| Q |
129 |
ggctgagcttcaaacaaacgttgtctccaaggtagctaactaaatatgatgaatccaaattttactgtagg-nnnnnnntattattgtactacatttaat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
33295425 |
ggctgagcttcaaacaaacgttgtctccaaggtagctaactaaatatgatgagaccaaagtttactgtaggaaaaaaaatattattgtactacatttaat |
33295326 |
T |
|
| Q |
228 |
aaattagaatagttgattcagtga |
251 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33295325 |
aaattagaatagttgattcagtga |
33295302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1463 times since January 2019
Visitors: 6143