View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_204 (Length: 251)
Name: NF0856_low_204
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_204 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 43098184 - 43098010
Alignment:
Q |
1 |
tagtattagaagagatcaacatcttaaataaatctcaattacttcaagagaattaatcttcaaaattgtgtaccaatgatacannnnnnnatgataatct |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
T |
43098184 |
tagtattagaagagatcaacatcttaaataaatctcaattacttcaagagaattaatcttcaaaattgtgtaccaataataca-ttttttatgataatct |
43098086 |
T |
 |
Q |
101 |
caattacaatggattagtttgattttaacatacatatgaaaaaataatctaacatctatgttagagactaaaatgatga |
179 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43098085 |
caattacaatggat---tttgattttaacatacatatgaaaaaataatctaacatctatgttagagactaaaatgatga |
43098010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3103 times since January 2019
Visitors: 6169