View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_205 (Length: 251)
Name: NF0856_low_205
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_205 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 10 - 251
Target Start/End: Original strand, 17746280 - 17746521
Alignment:
| Q |
10 |
aagaatatctaagactcaaaatatttatagatgttcttatatattatctatcaacgtagtatttatattgacattagattcaaatccaagtcatattaaa |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17746280 |
aagaaaatctaagactcaaaatatttatagatgttcttatatattatctatcaacgtagtatttatattgacattagattcaaatccaagtcatattaaa |
17746379 |
T |
|
| Q |
110 |
atatgagttgaattctaactaaatctaaatcataccaactgaatcaacttttgttgaccgtaaaaacttcttttggttttgactaataacagtttataat |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17746380 |
atatgagttgaattctaaccgaatctaaatcatactaactgaatcaacttttgttgaccgcaaaaacttcttttggttttgtctaataacagtttataat |
17746479 |
T |
|
| Q |
210 |
attaaacgtttgtctaattacatatttaatagacaaagatta |
251 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17746480 |
attaaacgtttgtctaatcacatatttaatagacaaagatta |
17746521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2777 times since January 2019
Visitors: 6167