View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_206 (Length: 251)
Name: NF0856_low_206
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_206 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 3430616 - 3430726
Alignment:
| Q |
1 |
agaataacgatgttatagaaccaagtatgaaaggaataacaaatattttttaatacatagataatgatgnnnnnnnatataggatgtccttatgcggatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3430616 |
agaataacgatgttatagaaccaagtatgaaaggaataacaaatattttttaatacatagataatgatgtttttttatataggatgtccttatgcggatt |
3430715 |
T |
|
| Q |
101 |
acaacatacac |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
3430716 |
acaacatacac |
3430726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 173 - 242
Target Start/End: Original strand, 3430791 - 3430862
Alignment:
| Q |
173 |
tgacgtttttacaatttaaaactctaattctgactttattggtagtaaaaacacttct--tactagtataat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3430791 |
tgacgtttttacaatttaaaactctaattctgactttattggtagtaaaaacacttcttatactagtataat |
3430862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2562 times since January 2019
Visitors: 6164