View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_207 (Length: 251)
Name: NF0856_low_207
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_207 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 46588148 - 46587923
Alignment:
Q |
19 |
ctttcgatacttcaggaaagaaaaaacagattgaaaccatccattttatttatatattgaattcaactaccttaaaaggaaaaaacttgattcaattggg |
118 |
Q |
|
|
||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
46588148 |
ctttcgatactccaggaaagaaaaaacagatggaaaccatccattttatttatattttgaattcaactaccttaaaaggaaataacttgattcaattggg |
46588049 |
T |
 |
Q |
119 |
ccatgagggctaaattaaaaggaacgtgtagatggaacagcaatgaacttggtgagtccagcaatacagtcataggcattaccttcatcagaggcaaagt |
218 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
46588048 |
ccatgagggttaaattaaaaggaacgtgtagatggaacagcaatgaacttggtgagtccagcaatacagtcataggcattgccttcatcagaggcaaagt |
46587949 |
T |
 |
Q |
219 |
aataaggcttcaactgattcatctca |
244 |
Q |
|
|
||||||||||||| ||||||| |||| |
|
|
T |
46587948 |
aataaggcttcaattgattcagctca |
46587923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2324 times since January 2019
Visitors: 6161