View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_208 (Length: 251)
Name: NF0856_low_208
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_208 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 11 - 239
Target Start/End: Original strand, 47025989 - 47026216
Alignment:
| Q |
11 |
aataacagttgctaatagttagatagataatatttaccgcttcgttaatagtttcaannnnnnncttttaactcaaattagttgagcagtccaactctag |
110 |
Q |
| |
|
||||||| ||||||||||||| || |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
47025989 |
aataacaattgctaatagttaaat---taatatttaccgcttcgttaatagtttcaatttttttcttttaactcaaattagttgagcagtccaactctgg |
47026085 |
T |
 |
| Q |
111 |
aagaagatggatggtactcgatca--gagacagctcgtgcatacatactgatgcacgctgaagtatgaccctaacattcgttgccgttcaattcaaagat |
208 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
47026086 |
aagaagatggatggtactcgatcaaagagacagctcgtgcttacatactgatgcacgctgaagtatgacactaatattcgttgccgttcaattcaaagat |
47026185 |
T |
 |
| Q |
209 |
tgtcccccctcttcaatctcccccaccttca |
239 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |
|
|
| T |
47026186 |
tgccccccctcttcaatctcccccaccttca |
47026216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University