View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_215 (Length: 248)
Name: NF0856_low_215
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_215 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 41609084 - 41609319
Alignment:
Q |
1 |
ttttcgacgaagattgatcatcatcactaacaactgtataaactttatacctataatataatacggtgatnnnnnnnnnnnnnnnntacaaaacctttat |
100 |
Q |
|
|
||||||||||| |||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
41609084 |
ttttcgacgaaaattgatcaccatcactaacaacggtagaaactttatacctataatataatacggtgataaaaaaaaaa------tacaaaacctttat |
41609177 |
T |
 |
Q |
101 |
ttattcccgtttgctaagtatatgtatacagcagcctatttatgctccttttgttctggtaacttggttaatgtttgaattcaatcaccttctagttcta |
200 |
Q |
|
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41609178 |
ttattcctgtttgctaagtatatgtatatagcagcctatttatgctccttttgttctggtaacttggttaatgtttgaattcaatcaccttctagttcta |
41609277 |
T |
 |
Q |
201 |
tagttaccatttttgatggctgttagtgccttctagaattat |
242 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41609278 |
tagttaccatttttgatggctgttagtgccttctagaattat |
41609319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University