View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_220 (Length: 241)
Name: NF0856_low_220
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_220 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 3 - 144
Target Start/End: Original strand, 56313692 - 56313833
Alignment:
| Q |
3 |
gaagaaggattgatgatgatgcag---cagcagcatcaacctaggcacctagtacaatatgctgctgcgggaaactctctgttagtctccgcttgtggtg |
99 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
56313692 |
gaagaaggattgatgattatgcagcagcagcagcatcaacctaggcacctagtacaatattcagctgcgggaaactctctgttagtctccgc---tggtg |
56313788 |
T |
 |
| Q |
100 |
gcggcgggggcgccattttccctgtctcagcttcagcagcagcag |
144 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
56313789 |
gcggcgggggcgtcattttccctgtctcagcttcagcagcagcag |
56313833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University