View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0856_low_220 (Length: 241)

Name: NF0856_low_220
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0856_low_220
NF0856_low_220
[»] chr4 (1 HSPs)
chr4 (3-144)||(56313692-56313833)


Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 3 - 144
Target Start/End: Original strand, 56313692 - 56313833
Alignment:
3 gaagaaggattgatgatgatgcag---cagcagcatcaacctaggcacctagtacaatatgctgctgcgggaaactctctgttagtctccgcttgtggtg 99  Q
    ||||||||||||||||| ||||||   ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||   |||||    
56313692 gaagaaggattgatgattatgcagcagcagcagcatcaacctaggcacctagtacaatattcagctgcgggaaactctctgttagtctccgc---tggtg 56313788  T
100 gcggcgggggcgccattttccctgtctcagcttcagcagcagcag 144  Q
    |||||||||||| ||||||||||||||||||||||||||||||||    
56313789 gcggcgggggcgtcattttccctgtctcagcttcagcagcagcag 56313833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University