View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_225 (Length: 239)
Name: NF0856_low_225
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_225 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 149
Target Start/End: Original strand, 11843154 - 11843201
Alignment:
Q |
102 |
ccatttaacaactctatttttcagtatggcctatatcgctcacaaatt |
149 |
Q |
|
|
|||||| ||||||||| |||||||||||||||||||| |||||||||| |
|
|
T |
11843154 |
ccatttgacaactctacttttcagtatggcctatatcactcacaaatt |
11843201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 50
Target Start/End: Original strand, 11843105 - 11843145
Alignment:
Q |
10 |
atttagcaaacatacttttcagcaaacacgttggcccactc |
50 |
Q |
|
|
|||||||||||||||||||||||||||| |||||| ||||| |
|
|
T |
11843105 |
atttagcaaacatacttttcagcaaacatgttggctcactc |
11843145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 144 - 233
Target Start/End: Original strand, 11788960 - 11789049
Alignment:
Q |
144 |
caaattcttgctttctctattttccactttcgcctctatttatgttgccatagggctattcttccttctcttccccctccttcatctcac |
233 |
Q |
|
|
|||| ||||| | ||| |||||||||||||| | ||||||||||| |||| || | |||||| |||||||||| ||||||||| |||| |
|
|
T |
11788960 |
caaactcttgttctctatattttccactttcacatctatttatgtcttcataaggtttttcttcattctcttcccgctccttcatttcac |
11789049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 228
Target Start/End: Original strand, 11823234 - 11823291
Alignment:
Q |
171 |
tttcgcctctatttatgttgccatagggctattcttccttctcttccccctccttcat |
228 |
Q |
|
|
|||| |||||||||| || |||||| || | ||||||||||||||||| ||||||||| |
|
|
T |
11823234 |
tttcccctctatttaggtcgccataaggtttttcttccttctcttcccgctccttcat |
11823291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2943 times since January 2019
Visitors: 6168