View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_232 (Length: 230)
Name: NF0856_low_232
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_232 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 9 - 200
Target Start/End: Original strand, 1638821 - 1639012
Alignment:
Q |
9 |
aaattaatatatttgaagtattaaataaagttaaatgatcaatgttgcacagtattgccttgtttcttttgtgagttcagtctaacattttttcatttcg |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1638821 |
aaattaatatatttgaagtattaaataaagttaaatgatcaatgttgcacagtattgccttgtttcttttgtgagttcagtctaacattttttcatttcg |
1638920 |
T |
 |
Q |
109 |
tttacgcctatttttatatatttgggagggaagagaaaacccttacaaattacagctcttttgcaagcaagaatgggttccgcatgttcaat |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
1638921 |
tttacgcctatttttatatatttgggagggaagagaaaacccttacaaattaccgctcttttgcaagcaagaatgggttccgcatgttcaat |
1639012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1487 times since January 2019
Visitors: 6143