View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_233 (Length: 228)
Name: NF0856_low_233
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_233 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 8 - 228
Target Start/End: Original strand, 41608568 - 41608785
Alignment:
| Q |
8 |
ttccaccttgaagttgacagggctttgcgtgcatctttgtttccctgtcataacatttgtatatttgggggtggaggtattcttacctcttcagaggctc |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41608568 |
ttccaccttgaagttcacagggctttgcgtacat---tgtttccctgtcataacatttgtatatttgggggtggaggtattcttacctcttcagaggctc |
41608664 |
T |
|
| Q |
108 |
gagtccctgctagcttttttaaaacctaatatgttttttgaattgcaaaataaaaatactgaattaaattggaatgcaagtcaacatatttttcatgtac |
207 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41608665 |
gagtccctgctagcttttttaaaatctaatatgttttttgaattgcaaaatgaaaatattgaattaatttggaatgcaagtcaacatatttttcatgtac |
41608764 |
T |
|
| Q |
208 |
tatttagttaacaagtttgaa |
228 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41608765 |
tatttagttaacaagtttgaa |
41608785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1347 times since January 2019
Visitors: 6140