View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_234 (Length: 228)
Name: NF0856_low_234
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_234 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 13 - 228
Target Start/End: Original strand, 41410665 - 41410879
Alignment:
| Q |
13 |
tctcaatattttctccaaccgannnnnnnncttctatttttgaactgtgatttgacatatgggacagtcaagttgtacagttgactaccacgtgtattat |
112 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41410665 |
tctcaatattttctccaaccgattttttt-cttctatttttgaactgtgatttgacatatgggacagtcaagttgtacagttgactaccacgtgtattat |
41410763 |
T |
|
| Q |
113 |
ttacaaaagtaagggatattcaggtccatacttgnnnnnnnagggagaatttggtcccaatnnnnnnnngaagcgaaattagtcattatatttcagtttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41410764 |
ttacaaaagtaagggatattcaggtccatacttgtttttttagggagaatttggtcccaataaaaaaaagaagcgaaattagtcattatatttcagtttt |
41410863 |
T |
|
| Q |
213 |
ttcataacaccaaaaa |
228 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41410864 |
ttcataacaccaaaaa |
41410879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2832 times since January 2019
Visitors: 6167