View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_235 (Length: 228)
Name: NF0856_low_235
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_235 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 49 - 131
Target Start/End: Original strand, 10425541 - 10425623
Alignment:
Q |
49 |
ccatttattaattgacactttctgtgttataaatatgacaggccttttggaattggtcatgggatgaacttgttacctatgat |
131 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
10425541 |
ccatttattaattgacactttctgtgttataaatatgacaggccttttggaattggtcatgggatgaacttgttatctatgat |
10425623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 10425493 - 10425523
Alignment:
Q |
1 |
accttctctaatacataaatttttctttgtc |
31 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
10425493 |
accttctctaatacataaatttttctttgtc |
10425523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University