View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0856_low_235 (Length: 228)

Name: NF0856_low_235
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0856_low_235
NF0856_low_235
[»] chr7 (2 HSPs)
chr7 (49-131)||(10425541-10425623)
chr7 (1-31)||(10425493-10425523)


Alignment Details
Target: chr7 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 49 - 131
Target Start/End: Original strand, 10425541 - 10425623
Alignment:
49 ccatttattaattgacactttctgtgttataaatatgacaggccttttggaattggtcatgggatgaacttgttacctatgat 131  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
10425541 ccatttattaattgacactttctgtgttataaatatgacaggccttttggaattggtcatgggatgaacttgttatctatgat 10425623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 10425493 - 10425523
Alignment:
1 accttctctaatacataaatttttctttgtc 31  Q
    |||||||||||||||||||||||||||||||    
10425493 accttctctaatacataaatttttctttgtc 10425523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University