View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_236 (Length: 227)
Name: NF0856_low_236
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_236 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 95 - 227
Target Start/End: Complemental strand, 33817418 - 33817286
Alignment:
| Q |
95 |
catcacagcttctagtgcttgacatcaactctaaatcaccattatccaccggtttagaaatgcccctgctcaacacttcttctgcaagatagaaaagcga |
194 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33817418 |
catcacaacttctagtgcttgacatcaactctaaatcaccattatccaccagtttagaaatgcccgtgctcaacacttcttctgcaagatagaaaagcga |
33817319 |
T |
 |
| Q |
195 |
gtacacttaaagtacacttaaaagtaaccatgt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33817318 |
gtacacttaaagtacacttaaaagtaaccatgt |
33817286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University