View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_238 (Length: 226)
Name: NF0856_low_238
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_238 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 12 - 226
Target Start/End: Original strand, 33990189 - 33990403
Alignment:
| Q |
12 |
agctgttgctcctaccaaacatgcaaaaggtattatatatacttcacattttcctagctctatctatgatcnnnnnnngtgtgcaaatatttcatcttgc |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33990189 |
agctattgctcctaccaaacatgcaaaaggtattatatatacttcacattttcctagctctatctatgatctttttttgtgtgcaaatatttcatcttgc |
33990288 |
T |
 |
| Q |
112 |
agattatataaaaacagttgacatttttgagaactgtggttgaaccaattttggtatctgcaccctcctaactgttgtttactgtgttttattattttct |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| | |
|
|
| T |
33990289 |
agattatacaaaaacagttgacatttttgagaactgtggttgaaccaattttggtatctgcaccctcctaactgttgtttactatgttttatgattgtag |
33990388 |
T |
 |
| Q |
212 |
agcccctgctgcatc |
226 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
33990389 |
agcacctgctgcatc |
33990403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University